update range to 10000 bp
locus tag: FAM13496-i1-1.1_000881 genome: FAM13496-i1-1.1
species: Streptococcus thermophilus taxid: 1308

Annotations

Type Name Description Pathways
KEGG reaction
 R08648 pyruvate:2-oxobutanoate acetaldehydetransferase (decarboxylating); Pyruvate + 2-Oxobutanoate <=> (S)-2-Aceto-2-hydroxybutanoate + CO2 kornec00290kornec01100kornec01110kornec01210kornec01230
KEGG reaction
 R04673 (S)-2-Aceto-2-hydroxybutanoate pyruvate-lyase (carboxylating); 2-Oxobutanoate + 2-(alpha-Hydroxyethyl)thiamine diphosphate <=> (S)-2-Aceto-2-hydroxybutanoate + Thiamin diphosphate
KEGG reaction
 R04672 (S)-2-Acetolactate pyruvate-lyase (carboxylating); (S)-2-Acetolactate + Thiamin diphosphate <=> 2-(alpha-Hydroxyethyl)thiamine diphosphate + Pyruvate
KEGG reaction
 R03050 2-Acetolactate pyruvate-lyase (carboxylating); 2-Acetolactate + Thiamin diphosphate <=> 2-(alpha-Hydroxyethyl)thiamine diphosphate + Pyruvate
KEGG reaction
 R00226 pyruvate:pyruvate acetaldehydetransferase (decarboxylating); (S)-2-acetolactate pyruvate-lyase (carboxylating); (S)-2-Acetolactate + CO2 <=> 2 Pyruvate kornec00290kornec00650kornec00660kornec00770kornec01100kornec01110kornec01210kornec01230
KEGG reaction
 R00014 pyruvate:thiamin diphosphate acetaldehydetransferase (decarboxylating); Pyruvate + Thiamin diphosphate <=> 2-(alpha-Hydroxyethyl)thiamine diphosphate + CO2 kornec00010kornec00020kornec00620
KEGG reaction
 R00006 pyruvate:pyruvate acetaldehydetransferase (decarboxylating); 2-acetolactate pyruvate-lyase (carboxylating); 2-Acetolactate + CO2 <=> 2 Pyruvate
Ortholog
 N0.HOG0001871 acetolactate synthase small subunit
KEGG gene
 K16785 ecfT; energy-coupling factor transport system permease protein kornec02010
KEGG gene
 K01653 E2.2.1.6S, ilvH, ilvN; acetolactate synthase I/III small subunit [EC:2.2.1.6] kornec00290kornec00650kornec00660kornec00770kornec01100kornec01110kornec01210kornec01230
Gene Code
 ilvN
Gene Ontology
 GO:1990234 transferase complex
Gene Ontology
 GO:1902494 catalytic complex
Gene Ontology
 GO:1901607 alpha-amino acid biosynthetic process
Gene Ontology
 GO:1901605 alpha-amino acid metabolic process
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0046394 carboxylic acid biosynthetic process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044444 obsolete cytoplasmic part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043436 oxoacid metabolic process
Gene Ontology
 GO:0032991 protein-containing complex
Gene Ontology
 GO:0019752 carboxylic acid metabolic process
Gene Ontology
 GO:0016744 transketolase or transaldolase activity
Gene Ontology
 GO:0016740 transferase activity
Gene Ontology
 GO:0016053 organic acid biosynthetic process
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009099 valine biosynthetic process
Gene Ontology
 GO:0009097 isoleucine biosynthetic process
Gene Ontology
 GO:0009082 branched-chain amino acid biosynthetic process
Gene Ontology
 GO:0009081 branched-chain amino acid metabolic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008652 cellular amino acid biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006573 valine metabolic process
Gene Ontology
 GO:0006549 isoleucine metabolic process
Gene Ontology
 GO:0006520 cellular amino acid metabolic process
Gene Ontology
 GO:0006082 organic acid metabolic process
Gene Ontology
 GO:0005948 acetolactate synthase complex
Gene Ontology
 GO:0005829 cytosol
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0003984 acetolactate synthase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Eggnog Protein
 EP:ilvN
Eggnog Ortholog
 EO:COG0440
Eggnog Description
 ED:Acetolactate synthase
EC Number
 EC:2.2.1.6 acetolactate synthase; alpha-acetohydroxy acid synthetase; alpha-acetohydroxyacid synthase; alpha-acetolactate synthase; alpha-acetolactate synthetase; acetohydroxy acid synthetase; acetohydroxyacid synthase; acetolactate pyruvate-lyase (carboxylating); acetolactic synthetase kornec00290kornec00650kornec00660kornec00770kornec01100kornec01110
Gene Product
 acetolactate synthase small subunit

Occurs in the following pathway maps:

Pathway Description
kornec00010 Glycolysis / Gluconeogenesis
kornec00020 Citrate cycle (TCA cycle)
kornec00290 Valine, leucine and isoleucine biosynthesis
kornec00620 Pyruvate metabolism
kornec00650 Butanoate metabolism
kornec00660 C5-Branched dibasic acid metabolism
kornec00770 Pantothenate and CoA biosynthesis
kornec01100 Metabolic pathways
kornec01110 Biosynthesis of secondary metabolites
kornec01210 2-Oxocarboxylic acid metabolism
kornec01230 Biosynthesis of amino acids
kornec02010 ABC transporters

Sequences

Nucleotide sequence (GC-content: 43.0 %):

ATGCGTAGAATGTTAACAGCTAAACTTCAGAACCGATCAGGTGTTCTTAACCGTTTCACTGGAGTGCTTTCACGCCGTCAGGTCAATATTGAGAGTATTTCCGTTGGAGCAACGGAAAATCCTGATGTTTCACGTATTACAATTATCATTGATGTGAATTCTCATAATGAGGTTGAGCAGATTATTAAACAGCTTAATCGTCAGATTGATGTGATTCGCATTCGTGACATCACTGATGTACCCCACTTGGAACGTGAGGTTATCTTGGTTAAGGTGTCGGCACCAACTTCTAAACGTGCTGAAATCTTGGCAATCATTCAACCTTTCCGTGCTTCGGTGGTGGATGTTGCACCAAGCTCTATCACTATCCAGATGACTGGAGATGCTGAAAAGAGTGAGGCGCTTCTACGAGTTATTCGACCTTACGGTATCAAGAATATTGCTCGTACGGGTGCTACTGGATTTACCCGTGATTAA

Protein sequence:

MRRMLTAKLQNRSGVLNRFTGVLSRRQVNIESISVGATENPDVSRITIIIDVNSHNEVEQIIKQLNRQIDVIRIRDITDVPHLEREVILVKVSAPTSKRAEILAIIQPFRASVVDVAPSSITIQMTGDAEKSEALLRVIRPYGIKNIARTGATGFTRD

GenBank Info

gene - ilvN
locus_tag - FAM13496-i1-1.1_000881
EC_number - 2.2.1.6
inference - COORDINATES: similar to AA sequence:RefSeq:WP_002927678.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - acetolactate synthase small subunit
protein_id - extdb:FAM13496-i1-1.1_000881

Gene Locus

Located on scaffold FAM13496-i1-1_scf10

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol
FAM13496-i1-1.1_000880
FAM13496-i1-1.1_000882