Annotations

Type Name Description Pathways
Gene Code
rplP
Ortholog
N0.HOG0001334 50S ribosomal protein L16
KEGG gene
K02878 RP-L16, MRPL16, rplP; large subunit ribosomal protein L16 kornec03010
Gene Ontology
GO:1990904 ribonucleoprotein complex
Gene Ontology
GO:1901363 heterocyclic compound binding
Gene Ontology
GO:0097159 organic cyclic compound binding
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044446 obsolete intracellular organelle part
Gene Ontology
GO:0044445 obsolete cytosolic part
Gene Ontology
GO:0044444 obsolete cytoplasmic part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044422 obsolete organelle part
Gene Ontology
GO:0044391 ribosomal subunit
Gene Ontology
GO:0043232 intracellular non-membrane-bounded organelle
Gene Ontology
GO:0043229 intracellular organelle
Gene Ontology
GO:0043228 non-membrane-bounded organelle
Gene Ontology
GO:0043226 organelle
Gene Ontology
GO:0032991 protein-containing complex
Gene Ontology
GO:0022626 cytosolic ribosome
Gene Ontology
GO:0022625 cytosolic large ribosomal subunit
Gene Ontology
GO:0019843 rRNA binding
Gene Ontology
GO:0015934 large ribosomal subunit
Gene Ontology
GO:0005840 ribosome
Gene Ontology
GO:0005829 cytosol
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0005488 binding
Gene Ontology
GO:0005198 structural molecule activity
Gene Ontology
GO:0003735 structural constituent of ribosome
Gene Ontology
GO:0003723 RNA binding
Gene Ontology
GO:0003676 nucleic acid binding
Gene Ontology
GO:0003674 molecular_function
Eggnog Protein
EP:rplP
Eggnog Ortholog
EO:COG0197
Eggnog Description
ED:Binds 23S rRNA and is also seen to make contacts with the A and possibly P site tRNAs
Gene Product
50S ribosomal protein L16

Occurs in the following pathway maps:

Pathway Description
kornec03010 Ribosome

Sequences

Nucleotide sequence (GC-content: 44.0 %):

ATGTTAGTACCTAAACGTGTTAAACACCGTCGTGAATTCCGTGGAAAAATGCGCGGTGAGGCTAAAGGTGGTAAAGAAGTATCATTCGGTGAATACGGTCTTCAAGCTACAACTAGCCACTGGATTACAAACCGTCAAATCGAGGCTGCTCGTATTGCCATGACTCGTTACATGAAACGTGGTGGTAAGGTTTGGATTAAGATCTTCCCACACAAATCATACACTGCTAAAGCTATCGGTGTACGTATGGGTTCTGGTAAAGGGGCACCTGAAGGTTGGGTAGCACCAGTTAAACGTGGTAAAGTAATGTTCGAAATCGCAGGTGTTTCTGAAGAAGTTGCACGTGAAGCGCTTCGTCTTGCTAGCCACAAATTGCCAGTTAAATCTAAATTCGTGAAACGTGAAGCAGAATAA

Protein sequence:

MLVPKRVKHRREFRGKMRGEAKGGKEVSFGEYGLQATTSHWITNRQIEAARIAMTRYMKRGGKVWIKIFPHKSYTAKAIGVRMGSGKGAPEGWVAPVKRGKVMFEIAGVSEEVAREALRLASHKLPVKSKFVKREAE

GenBank Info

gene - rplP
locus_tag - FAM13496-i1-1.1_000923
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003029477.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - 50S ribosomal protein L16
protein_id - extdb:FAM13496-i1-1.1_000923

Gene Locus

Located on scaffold FAM13496-i1-1_scf10


Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol

FAM13496-i1-1.1_000922
FAM13496-i1-1.1_000924