update range to 10000 bp
locus tag: FAM13496-i1-1.1_001362 genome: FAM13496-i1-1.1
species: Streptococcus thermophilus taxid: 1308

Annotations

Type Name Description Pathways
Gene Product
 transcription elongation factor GreA
Ortholog
 N0.HOG0000836 transcription elongation factor GreA
KEGG gene
 K03624 greA; transcription elongation factor GreA
Gene Code
 greA
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901362 organic cyclic compound biosynthetic process
Gene Ontology
 GO:1901360 organic cyclic compound metabolic process
Gene Ontology
 GO:0097659 nucleic acid-templated transcription
Gene Ontology
 GO:0090304 nucleic acid metabolic process
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0046483 heterocycle metabolic process
Gene Ontology
 GO:0044271 cellular nitrogen compound biosynthetic process
Gene Ontology
 GO:0044260 cellular macromolecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043170 macromolecule metabolic process
Gene Ontology
 GO:0034654 nucleobase-containing compound biosynthetic process
Gene Ontology
 GO:0034645 cellular macromolecule biosynthetic process
Gene Ontology
 GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
 GO:0032774 RNA biosynthetic process
Gene Ontology
 GO:0019438 aromatic compound biosynthetic process
Gene Ontology
 GO:0018130 heterocycle biosynthetic process
Gene Ontology
 GO:0016070 RNA metabolic process
Gene Ontology
 GO:0010467 gene expression
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009059 macromolecule biosynthetic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
 GO:0006354 DNA-templated transcription elongation
Gene Ontology
 GO:0006351 DNA-templated transcription
Gene Ontology
 GO:0006139 nucleobase-containing compound metabolic process
Eggnog Protein
 EP:greA
Eggnog Ortholog
 EO:COG0782
Eggnog Description
 ED:Necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites. The arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through

Sequences

Nucleotide sequence (GC-content: 40.2 %):

ATGGCAGAAAAAACATATGTAATGACCCTAGCAGAAAAAAAACAACTTGAAGCAGAATTGGAGGAGTACAAACTCGTACGTCGCCCAGAAGTTGTAGAACGCATCAAGATTGCCCGTTCTTATGGTGACCTTTCAGAAAACTCTGAGTATGAGGCGGCTAAAGATGAGCAAGCCTTTATTGAAGGTCAAATTCAAATTCTTGAAACAAAGATTCGTTACGCAGAGATCGTTGATAGTGATGCTGTTGCCAATGACGAAGTTGCGATTGGTAAAACAGTTGTTGTGCAAGAAGTTGGTACAAGCGACAAAGATACTTACCATATCGTTGGTGCAGCCGGTGCTGATATTTTCTCAGGTAAAATTTCAAATGAAAGCCCAATTGCTCAAGCCTTGATTGGTAAGAAAGTTGGAGATAAAGTAGCTATCGAATCACCAGCAGGTAGCTACTCTGTTGAAATCCTTAGTGTAGAAAAAACATCCTAA

Protein sequence:

MAEKTYVMTLAEKKQLEAELEEYKLVRRPEVVERIKIARSYGDLSENSEYEAAKDEQAFIEGQIQILETKIRYAEIVDSDAVANDEVAIGKTVVVQEVGTSDKDTYHIVGAAGADIFSGKISNESPIAQALIGKKVGDKVAIESPAGSYSVEILSVEKTS

GenBank Info

gene - greA
locus_tag - FAM13496-i1-1.1_001362
inference - COORDINATES: similar to AA sequence:RefSeq:NP_688603.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - transcription elongation factor GreA
protein_id - extdb:FAM13496-i1-1.1_001362

Gene Locus

Located on scaffold FAM13496-i1-1_scf19

FAM13496-i1-1.1_001361
FAM13496-i1-1.1_001363