update range to 10000 bp
locus tag: FAM19038-p1-1.1_001761 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
KEGG reaction
 R00260 glutamate racemase; L-Glutamate <=> D-Glutamate kornec00471kornec01100
Ortholog
 N0.HOG0001141 glutamate racemase
KEGG gene
 K01776 murI; glutamate racemase [EC:5.1.1.3] kornec00471kornec01100
Gene Ontology
 GO:2000372 negative regulation of DNA topoisomerase (ATP-hydrolyzing) activity
Gene Ontology
 GO:2000371 regulation of DNA topoisomerase (ATP-hydrolyzing) activity
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:1901137 carbohydrate derivative biosynthetic process
Gene Ontology
 GO:1901135 carbohydrate derivative metabolic process
Gene Ontology
 GO:0098772 molecular function regulator activity
Gene Ontology
 GO:0072586 DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) regulator activity
Gene Ontology
 GO:0071944 cell periphery
Gene Ontology
 GO:0071840 cellular component organization or biogenesis
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0071554 cell wall organization or biogenesis
Gene Ontology
 GO:0070589 cellular component macromolecule biosynthetic process
Gene Ontology
 GO:0065009 regulation of molecular function
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0060590 ATPase regulator activity
Gene Ontology
 GO:0060589 nucleoside-triphosphatase regulator activity
Gene Ontology
 GO:0051346 negative regulation of hydrolase activity
Gene Ontology
 GO:0051336 regulation of hydrolase activity
Gene Ontology
 GO:0050790 regulation of catalytic activity
Gene Ontology
 GO:0047661 amino-acid racemase activity
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044260 cellular macromolecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0044092 negative regulation of molecular function
Gene Ontology
 GO:0044085 cellular component biogenesis
Gene Ontology
 GO:0044038 cell wall macromolecule biosynthetic process
Gene Ontology
 GO:0044036 cell wall macromolecule metabolic process
Gene Ontology
 GO:0043462 regulation of ATP-dependent activity
Gene Ontology
 GO:0043170 macromolecule metabolic process
Gene Ontology
 GO:0043086 negative regulation of catalytic activity
Gene Ontology
 GO:0042546 cell wall biogenesis
Gene Ontology
 GO:0042030 ATPase inhibitor activity
Gene Ontology
 GO:0036361 racemase activity, acting on amino acids and derivatives
Gene Ontology
 GO:0034645 cellular macromolecule biosynthetic process
Gene Ontology
 GO:0032780 negative regulation of ATP-dependent activity
Gene Ontology
 GO:0030234 enzyme regulator activity
Gene Ontology
 GO:0030203 glycosaminoglycan metabolic process
Gene Ontology
 GO:0016855 racemase and epimerase activity, acting on amino acids and derivatives
Gene Ontology
 GO:0016854 racemase and epimerase activity
Gene Ontology
 GO:0016853 isomerase activity
Gene Ontology
 GO:0016020 membrane
Gene Ontology
 GO:0010911 regulation of isomerase activity
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009273 peptidoglycan-based cell wall biogenesis
Gene Ontology
 GO:0009252 peptidoglycan biosynthetic process
Gene Ontology
 GO:0009059 macromolecule biosynthetic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008881 glutamate racemase activity
Gene Ontology
 GO:0008657 DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) inhibitor activity
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006024 glycosaminoglycan biosynthetic process
Gene Ontology
 GO:0006023 aminoglycan biosynthetic process
Gene Ontology
 GO:0006022 aminoglycan metabolic process
Gene Ontology
 GO:0005886 plasma membrane
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0004857 enzyme inhibitor activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0000270 peptidoglycan metabolic process
Gene Product
 glutamate racemase
Eggnog Protein
 EP:murI
Eggnog Ortholog
 EO:COG0796
Eggnog Description
 ED:Provides the (R)-glutamate required for cell wall biosynthesis
EC Number
 EC:5.1.1.3 glutamate racemase kornec00471kornec01100

Occurs in the following pathway maps:

Pathway Description
kornec00471 D-Glutamine and D-glutamate metabolism
kornec01100 Metabolic pathways

Sequences

Nucleotide sequence (GC-content: 70.8 %):

GTGAGCGATGATCCGGCCGGACCTGACGAGAACACCGTCGACTCACCGATCGGGGTCTTCGACTCCGGTTTCGGTGGGCTGACGGTGGCCCGGGCCGCCGTGGACCTGATGCCCAACGAGGACATCATCTATCTCGGCGACACGGCCCGGGCGCCCTACGGCGAGAAGCACATCGCCCAGGTCCGCCACTACGCCCTGCAGTGCCTCGACCGGCTCAACACGCACGGTGTCAAGGCCTTGGTGATCGCCTGCAACACCGCCTCCTCGGCGGTGCTGCGCGATGCCCGGGAGCGCTACGACGTGCCGGTCATCGACGTCATCATGCCCGCCGCCCGGCGCGCCTCGCTGGTCACCCGCAACGGTCGGATCGGGGTGATCTGCACCGAGGCGACCGCCCGATCGCGGTCCTACGAGGATGCCCTGGCCGCGGTGCCGGGGGTCCGCCTGACCACCTCCCCCTGCCCCCGGTTCGTCGAGTTCGTCGAGCGGGGGATCACCGGCGGCCCCGAGCTGGAGGCGGTGGCGCGCCAGTACCTGGCGCCGATCCGGGAGGCCGGCTGCGACACCGTGATCCTGGGGTGCACCCACTACCCGCTGCTGGCCGGTCTGATCAGTATGACCCTGGGCGACGAGGTGACCCTGGTGTCCTCCTCCGAGGAGTGCGCCCGGGCCTCCTACGCGGTCCTCACCCGGCGCGGCATCCTGCACACCGCCCCGAGGGAGCCGAGCCGCTACTTCCTCACCACCGGAAACGCCGAGAAGTTCGAACGGCTGGGACGCCGGCTGATGCAGGGATTCGTCCGCGACGTGCACCGAGTGGGGATGGACGAGACGCCGGCCCTGCTGGGCGACCGGGCCTTCGTGCGCTCCGCCGACGAGCCGGTCTCCTGA

Protein sequence:

MSDDPAGPDENTVDSPIGVFDSGFGGLTVARAAVDLMPNEDIIYLGDTARAPYGEKHIAQVRHYALQCLDRLNTHGVKALVIACNTASSAVLRDARERYDVPVIDVIMPAARRASLVTRNGRIGVICTEATARSRSYEDALAAVPGVRLTTSPCPRFVEFVERGITGGPELEAVARQYLAPIREAGCDTVILGCTHYPLLAGLISMTLGDEVTLVSSSEECARASYAVLTRRGILHTAPREPSRYFLTTGNAEKFERLGRRLMQGFVRDVHRVGMDETPALLGDRAFVRSADEPVS

GenBank Info

locus_tag - FAM19038-p1-1.1_001761
EC_number - 5.1.1.3
inference - COORDINATES: similar to AA sequence:RefSeq:WP_002523589.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - glutamate racemase
protein_id - extdb:FAM19038-p1-1.1_001761

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

Cellular location expand

Responsible annotations:
SL-0039: GO:0005886 plasma membrane
SL-0162: GO:0016020 membrane
FAM19038-p1-1.1_001760
FAM19038-p1-1.1_001762