update range to 10000 bp
locus tag: FAM19038-p1-1.1_002088 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
Gene Product
 response regulator transcription factor
Ortholog
 N0.HOG0000079 response regulator transcription factor
KEGG gene
 K07670 mtrA; two-component system, OmpR family, response regulator MtrA kornec02020
Gene Ontology
 GO:2001141 regulation of RNA biosynthetic process
Gene Ontology
 GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
 GO:1903508 positive regulation of nucleic acid-templated transcription
Gene Ontology
 GO:1903506 regulation of nucleic acid-templated transcription
Gene Ontology
 GO:1902680 positive regulation of RNA biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:0080090 regulation of primary metabolic process
Gene Ontology
 GO:0071944 cell periphery
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
 GO:0051704 obsolete multi-organism process
Gene Ontology
 GO:0051254 positive regulation of RNA metabolic process
Gene Ontology
 GO:0051252 regulation of RNA metabolic process
Gene Ontology
 GO:0051173 positive regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0045935 positive regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0045893 positive regulation of DNA-templated transcription
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044419 biological process involved in interspecies interaction between organisms
Gene Ontology
 GO:0044403 biological process involved in symbiotic interaction
Gene Ontology
 GO:0044267 -
Gene Ontology
 GO:0044260 cellular macromolecule metabolic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0044117 -
Gene Ontology
 GO:0044116 -
Gene Ontology
 GO:0044110 obsolete growth involved in symbiotic interaction
Gene Ontology
 GO:0043412 macromolecule modification
Gene Ontology
 GO:0043170 macromolecule metabolic process
Gene Ontology
 GO:0040007 growth
Gene Ontology
 GO:0036211 protein modification process
Gene Ontology
 GO:0031328 positive regulation of cellular biosynthetic process
Gene Ontology
 GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
 GO:0031325 positive regulation of cellular metabolic process
Gene Ontology
 GO:0031323 regulation of cellular metabolic process
Gene Ontology
 GO:0019538 protein metabolic process
Gene Ontology
 GO:0019222 regulation of metabolic process
Gene Ontology
 GO:0019219 regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0016310 phosphorylation
Gene Ontology
 GO:0016020 membrane
Gene Ontology
 GO:0010628 positive regulation of gene expression
Gene Ontology
 GO:0010604 positive regulation of macromolecule metabolic process
Gene Ontology
 GO:0010557 positive regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010468 regulation of gene expression
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009893 positive regulation of metabolic process
Gene Ontology
 GO:0009891 positive regulation of biosynthetic process
Gene Ontology
 GO:0009889 regulation of biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006796 phosphate-containing compound metabolic process
Gene Ontology
 GO:0006793 phosphorus metabolic process
Gene Ontology
 GO:0006468 protein phosphorylation
Gene Ontology
 GO:0006464 -
Gene Ontology
 GO:0006355 regulation of DNA-templated transcription
Gene Ontology
 GO:0005886 plasma membrane
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005575 cellular_component
Eggnog Protein
 EP:mtrA
Eggnog Ortholog
 EO:COG0745
Eggnog Description
 ED:Transcriptional regulatory protein

Occurs in the following pathway maps:

Pathway Description
kornec02020 Two-component system

Sequences

Nucleotide sequence (GC-content: 67.9 %):

ATGGCATCAGGGCAAGGCGGCACCGGGGGCCGCAACCACCGGTCGCGCACCATCAGGACTGTCCTGTGTGCAGCTGCGGACTACCATGTGACTGGATTCCGACAGGGGGCGTCGAGAGTCGGTGAAGAACGAGGAGGCCGAAGCGTGACCCAGCCCAGCGCCGAGTCGACGGGCCAGCGGATACTCGTGGTCGACGACGACCCTGCCCTGGCAGAGATGCTCCAGCTCGTGCTCCACAAGGAACGATTCGTCACCGACTGGTGCGCCAGCGGTTCGCGGGCCCTCGACGTCTTCGACCGGTTCAAGCCCGATCTCATCCTGCTGGACCTGATGCTCCCCGGACGCAACGGGATCGACGTCTGCCGGGAGGTGCGGCGGGTCTCGGGGGTCCCGATCATCATGCTCACCGCCCGCTCCGACACCCAGGACGTGGTCTCCGGGCTGGAGGCCGGCGCGGACGACTACGTCTCCAAGCCCTTCAAGTCCAAGGAGCTGGTGGCCCGCATCCGGACCCGCCTGAGACAACCCCTGGAGGCGGCGACCGACACCGAGTCCGATGTGACATCGATCGGCGATCTGGTCATCGACGTGCGCGCCCACCAGGTGACCCGAGGCGGACAGGAGATCCCCCTCACCCCGCTCGAGTTCGACGTCCTGGTCGCCCTGGCACGCCGCCCGCACGACGTGTTCAGTCGCGACGCCCTCCTCGAGGAGGTGTGGGGGTACCGTCACGCCGCCGACACCCGACTGGTCAACGTCCACGTCCAGCGGCTGCGCTCCAAGATCGAGCGCGACCCTGAGCACCCCAGCATCGTCATCACCGTTCGTGGGGTCGGCTACCGGGCCGGCTCCGGTGACCGGGAGGAGAACTGA

Protein sequence:

MASGQGGTGGRNHRSRTIRTVLCAAADYHVTGFRQGASRVGEERGGRSVTQPSAESTGQRILVVDDDPALAEMLQLVLHKERFVTDWCASGSRALDVFDRFKPDLILLDLMLPGRNGIDVCREVRRVSGVPIIMLTARSDTQDVVSGLEAGADDYVSKPFKSKELVARIRTRLRQPLEAATDTESDVTSIGDLVIDVRAHQVTRGGQEIPLTPLEFDVLVALARRPHDVFSRDALLEEVWGYRHAADTRLVNVHVQRLRSKIERDPEHPSIVITVRGVGYRAGSGDREEN

GenBank Info

locus_tag - FAM19038-p1-1.1_002088
inference - COORDINATES: similar to AA sequence:RefSeq:WP_012245052.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - response regulator transcription factor
protein_id - extdb:FAM19038-p1-1.1_002088

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

Cellular location expand

Responsible annotations:
SL-0039: GO:0005886 plasma membrane
SL-0162: GO:0016020 membrane
FAM19038-p1-1.1_002087
FAM19038-p1-1.1_002089