update range to 10000 bp
locus tag: FAM19038-p1-1.1_002322 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
Gene Product
 shikimate kinase
KEGG reaction
 R02412 ATP:shikimate 3-phosphotransferase; ATP + Shikimate <=> ADP + Shikimate 3-phosphate kornec00400kornec01100kornec01110kornec01230
Ortholog
 N0.HOG0000958 shikimate kinase
KEGG gene
 K00891 aroK, aroL; shikimate kinase [EC:2.7.1.71] kornec00400kornec01100kornec01110kornec01230
Gene Ontology
 GO:1901615 organic hydroxy compound metabolic process
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:1901362 organic cyclic compound biosynthetic process
Gene Ontology
 GO:1901360 organic cyclic compound metabolic process
Gene Ontology
 GO:1901265 nucleoside phosphate binding
Gene Ontology
 GO:0097367 carbohydrate derivative binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0046872 metal ion binding
Gene Ontology
 GO:0046417 chorismate metabolic process
Gene Ontology
 GO:0046394 carboxylic acid biosynthetic process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044444 obsolete cytoplasmic part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043650 dicarboxylic acid biosynthetic process
Gene Ontology
 GO:0043648 dicarboxylic acid metabolic process
Gene Ontology
 GO:0043436 oxoacid metabolic process
Gene Ontology
 GO:0043169 cation binding
Gene Ontology
 GO:0043168 anion binding
Gene Ontology
 GO:0043167 ion binding
Gene Ontology
 GO:0040007 growth
Gene Ontology
 GO:0036094 small molecule binding
Gene Ontology
 GO:0035639 purine ribonucleoside triphosphate binding
Gene Ontology
 GO:0032787 monocarboxylic acid metabolic process
Gene Ontology
 GO:0032559 adenyl ribonucleotide binding
Gene Ontology
 GO:0032555 purine ribonucleotide binding
Gene Ontology
 GO:0032553 ribonucleotide binding
Gene Ontology
 GO:0030554 adenyl nucleotide binding
Gene Ontology
 GO:0019752 carboxylic acid metabolic process
Gene Ontology
 GO:0019632 shikimate metabolic process
Gene Ontology
 GO:0019438 aromatic compound biosynthetic process
Gene Ontology
 GO:0017076 purine nucleotide binding
Gene Ontology
 GO:0016773 phosphotransferase activity, alcohol group as acceptor
Gene Ontology
 GO:0016772 transferase activity, transferring phosphorus-containing groups
Gene Ontology
 GO:0016740 transferase activity
Gene Ontology
 GO:0016310 phosphorylation
Gene Ontology
 GO:0016301 kinase activity
Gene Ontology
 GO:0016053 organic acid biosynthetic process
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009423 chorismate biosynthetic process
Gene Ontology
 GO:0009073 aromatic amino acid family biosynthetic process
Gene Ontology
 GO:0009072 aromatic amino acid family metabolic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008652 cellular amino acid biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0008144 obsolete drug binding
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006796 phosphate-containing compound metabolic process
Gene Ontology
 GO:0006793 phosphorus metabolic process
Gene Ontology
 GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
 GO:0006520 cellular amino acid metabolic process
Gene Ontology
 GO:0006082 organic acid metabolic process
Gene Ontology
 GO:0005829 cytosol
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005524 ATP binding
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0004765 shikimate kinase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0000287 magnesium ion binding
Gene Ontology
 GO:0000166 nucleotide binding
Eggnog Protein
 EP:aroK
Eggnog Ortholog
 EO:COG0703
Eggnog Description
 ED:Catalyzes the specific phosphorylation of the 3-hydroxyl group of shikimic acid using ATP as a cosubstrate
EC Number
 EC:2.7.1.71 shikimate kinase; shikimate kinase (phosphorylating); shikimate kinase II kornec00400kornec01100kornec01110

Occurs in the following pathway maps:

Pathway Description
kornec00400 Phenylalanine, tyrosine and tryptophan biosynthesis
kornec01100 Metabolic pathways
kornec01110 Biosynthesis of secondary metabolites
kornec01230 Biosynthesis of amino acids

Sequences

Nucleotide sequence (GC-content: 70.1 %):

GTGATTGCGATCATCGGTGCCCCAGGATCGGGCAAGTCGACCGTCGGACCGCTGCTGGCCGCACGGCTGGGCCTCGACTTCGTCGACGTCGACGAGGTGATCAGCCGGGTCGAGGGACGTCCCATCAGCGACATCTTCGCCACCGACGGGGAGCCCTACTTCCGCGAGGTGGAGGCCCGCGAGACCCTCGCGGCGCTGGCCGCCGGGGGAGTGGTCTCGCTCGGTGGGGGCGCCCCCCTCACCCCCAGCATCGGGCAGGCTCTGGACCGGGTTCGCACCGTCTGGCTGGAGGTCAGCGCCCGCACCGCCTCCGGACGGGTCGGGCTCAATGACGCCACCCGTCCCCTGCTGCTGGGCAACGTGCACTCCCGGATGGTGCGCCTGCTGGCCGAGCGGCGTCCGGTCTACGCGGCCCCGGCCGACATCCATGTGGTCACCGACTCGCTGCACCCGGGACAGATCGTCGAACAGATCCTGGTGGAGCTTCAGGGTCTGCCCGAGGCCACCGGAGTCATCGAGACATCAGCCAACGAGACGGGGGAGCAGTCATGA

Protein sequence:

MIAIIGAPGSGKSTVGPLLAARLGLDFVDVDEVISRVEGRPISDIFATDGEPYFREVEARETLAALAAGGVVSLGGGAPLTPSIGQALDRVRTVWLEVSARTASGRVGLNDATRPLLLGNVHSRMVRLLAERRPVYAAPADIHVVTDSLHPGQIVEQILVELQGLPEATGVIETSANETGEQS

GenBank Info

locus_tag - FAM19038-p1-1.1_002322
inference - COORDINATES: similar to AA sequence:RefSeq:WP_002516811.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - shikimate kinase
protein_id - extdb:FAM19038-p1-1.1_002322

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol
FAM19038-p1-1.1_002321
FAM19038-p1-1.1_002323