update range to 10000 bp
locus tag: FAM19038-p1-1.1_002346 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
Gene Code
 secF
Gene Product
 protein translocase subunit SecF
Ortholog
 N0.HOG0002141 protein translocase subunit SecF
KEGG gene
 K03074 secF; preprotein translocase subunit SecF kornec03060kornec03070
KEGG gene
 K03072 secD; preprotein translocase subunit SecD kornec03060kornec03070
Gene Ontology
 GO:0071944 cell periphery
Gene Ontology
 GO:0071705 nitrogen compound transport
Gene Ontology
 GO:0071702 organic substance transport
Gene Ontology
 GO:0051234 establishment of localization
Gene Ontology
 GO:0051179 localization
Gene Ontology
 GO:0045184 establishment of protein localization
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044459 obsolete plasma membrane part
Gene Ontology
 GO:0044425 obsolete membrane part
Gene Ontology
 GO:0042886 amide transport
Gene Ontology
 GO:0033036 macromolecule localization
Gene Ontology
 GO:0031226 intrinsic component of plasma membrane
Gene Ontology
 GO:0031224 intrinsic component of membrane
Gene Ontology
 GO:0030312 external encapsulating structure
Gene Ontology
 GO:0016021 integral component of membrane
Gene Ontology
 GO:0016020 membrane
Gene Ontology
 GO:0015833 peptide transport
Gene Ontology
 GO:0015031 protein transport
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0008104 protein localization
Gene Ontology
 GO:0006810 transport
Gene Ontology
 GO:0005887 integral component of plasma membrane
Gene Ontology
 GO:0005886 plasma membrane
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005618 cell wall
Gene Ontology
 GO:0005575 cellular_component
Eggnog Protein
 EP:secF
Eggnog Ortholog
 EO:COG0341
Eggnog Description
 ED:Part of the Sec protein translocase complex. Interacts with the SecYEG preprotein conducting channel. SecDF uses the proton motive force (PMF) to complete protein translocation after the ATP-dependent function of SecA

Occurs in the following pathway maps:

Pathway Description
kornec03060 Protein export
kornec03070 Bacterial secretion system

Sequences

Nucleotide sequence (GC-content: 68.2 %):

ATGGCTGAGCGCAAGACCGGCTTCGCCCATGCGCTGTACACCGGCGCGATCTCCTACTCCTTCGTCGGACGGCGCAAGGTCTGGTACATCCTCTCCGCGGTGCTCATCGCGATCTCCGTCCTCGGACTGGCGGTCCGCGGACTCAACCTGGGTATCGACTTCCGCGGCGGCGTGGAGTTCAACGCCCCGGTGGCGGTGAGCGCCGGGACCACCGACACGGTGCGCTCGGCGGTGACCTCCTCGGGGGTCTCCGACCTGGACGGCACCGAGGTCGTCACCGTGGGGTCTGACTACGTCCGGGTGCAGACCCGCCCGCTCAGCCCCTCCGAGACGGTGACGATCCGCGAGGCCCTCGCCCGCGCCACCCACGCCGACTCCGGTGCGGTCACCTACTCCAATGTCGGCGCCCAGTGGGGCCAGCAGATCACCAACAAGGGGCTCCAGGCCCTGGCGGTGTTCCTGGTCCTGGTGATGCTGCTGATCTGGATCTACTTCCGCGAGTGGAAGATGTCGGTCTCGGCGGTGATCGCCATGCTCCACGACATCATCGTGACGGTCGGCGTCTACGCCCTGGTCGGCTTCACCGTCACCCCCTCGACCCTCATCGGGGTGCTCACCATCCTGGGCTACTCGCTGTACGACACGGTGGTGGTCTTCGACAAGGTCCGTGAGAACACCGCCGATCTGAACAGTCGTGACATCACCTACTCCGAGGGAGCCAACCGGGCCGTCAACCAGGTCCTGGTCCGGTCCATCAACACCACGATCATCGGCGTCCTGCCGGTGGCCGCGCTGCTCTTCGCCGGTGCCTTCCTGCTCGGCTCGGGACCCCTGGAGGATCTCGGCCTGGCCCTGTTCGTCGGCATGATCGTCGGCGCCTACTCGTCGATCTTCATCGCCACCCCGATCCTGGCTCAGCTGCGCGAGCGCGAGCCGGAGGTTCACGCACACACCGAGGCGGTGCTGCGGCGCCGCGCCAAGGCCGCCCAGGACGCCCCGAAGGTGAGCGCCCAGACGGTCCGGACCGAGGCGGCCGGCGTCGCCGACCTGCCCGAGTCGGTCCCGGGGGCCGATGCCCCGTCCGGATCCTCGAACCGGTCCCAGAACCCTCGCACCACCCGATCGCAGAGGAAGAAATGA

Protein sequence:

MAERKTGFAHALYTGAISYSFVGRRKVWYILSAVLIAISVLGLAVRGLNLGIDFRGGVEFNAPVAVSAGTTDTVRSAVTSSGVSDLDGTEVVTVGSDYVRVQTRPLSPSETVTIREALARATHADSGAVTYSNVGAQWGQQITNKGLQALAVFLVLVMLLIWIYFREWKMSVSAVIAMLHDIIVTVGVYALVGFTVTPSTLIGVLTILGYSLYDTVVVFDKVRENTADLNSRDITYSEGANRAVNQVLVRSINTTIIGVLPVAALLFAGAFLLGSGPLEDLGLALFVGMIVGAYSSIFIATPILAQLREREPEVHAHTEAVLRRRAKAAQDAPKVSAQTVRTEAAGVADLPESVPGADAPSGSSNRSQNPRTTRSQRKK

GenBank Info

gene - secF
locus_tag - FAM19038-p1-1.1_002346
inference - COORDINATES: similar to AA sequence:RefSeq:WP_015070507.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - protein translocase subunit SecF
protein_id - extdb:FAM19038-p1-1.1_002346

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

Cellular location expand

Responsible annotations:
SL-0041: GO:0005618 cell wall
SL-0039: GO:0005886 plasma membrane
SL-0162: GO:0016020 membrane
FAM19038-p1-1.1_002345
FAM19038-p1-1.1_002347