update range to 10000 bp
locus tag: FAM19038-p1-1.1_002414 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
KEGG reaction
 R11896 5-fluorodeoxyuridine-triphosphate diphosphohydrolase; 5-Fluorodeoxyuridine triphosphate + H2O <=> 5-Fluorodeoxyuridine monophosphate + Diphosphate kornec00983
KEGG reaction
 R02100 dUTP nucleotidohydrolase; dUTP + H2O <=> dUMP + Diphosphate kornec00240kornec01100
Ortholog
 N0.HOG0003276 dUTP diphosphatase
KEGG gene
 K01520 dut, DUT; dUTP pyrophosphatase [EC:3.6.1.23] kornec00240kornec00983kornec01100
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901575 organic substance catabolic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901565 organonitrogen compound catabolic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:1901362 organic cyclic compound biosynthetic process
Gene Ontology
 GO:1901361 organic cyclic compound catabolic process
Gene Ontology
 GO:1901360 organic cyclic compound metabolic process
Gene Ontology
 GO:1901293 nucleoside phosphate biosynthetic process
Gene Ontology
 GO:1901292 nucleoside phosphate catabolic process
Gene Ontology
 GO:1901137 carbohydrate derivative biosynthetic process
Gene Ontology
 GO:1901136 carbohydrate derivative catabolic process
Gene Ontology
 GO:1901135 carbohydrate derivative metabolic process
Gene Ontology
 GO:0090407 organophosphate biosynthetic process
Gene Ontology
 GO:0072529 pyrimidine-containing compound catabolic process
Gene Ontology
 GO:0072528 pyrimidine-containing compound biosynthetic process
Gene Ontology
 GO:0072527 pyrimidine-containing compound metabolic process
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0055086 nucleobase-containing small molecule metabolic process
Gene Ontology
 GO:0047429 nucleoside triphosphate diphosphatase activity
Gene Ontology
 GO:0046872 metal ion binding
Gene Ontology
 GO:0046700 heterocycle catabolic process
Gene Ontology
 GO:0046483 heterocycle metabolic process
Gene Ontology
 GO:0046434 organophosphate catabolic process
Gene Ontology
 GO:0046386 deoxyribose phosphate catabolic process
Gene Ontology
 GO:0046385 deoxyribose phosphate biosynthetic process
Gene Ontology
 GO:0046081 dUTP catabolic process
Gene Ontology
 GO:0046080 dUTP metabolic process
Gene Ontology
 GO:0046078 dUMP metabolic process
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044271 cellular nitrogen compound biosynthetic process
Gene Ontology
 GO:0044270 cellular nitrogen compound catabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044248 cellular catabolic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043169 cation binding
Gene Ontology
 GO:0043167 ion binding
Gene Ontology
 GO:0034655 nucleobase-containing compound catabolic process
Gene Ontology
 GO:0034654 nucleobase-containing compound biosynthetic process
Gene Ontology
 GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
 GO:0034404 nucleobase-containing small molecule biosynthetic process
Gene Ontology
 GO:0019692 deoxyribose phosphate metabolic process
Gene Ontology
 GO:0019637 organophosphate metabolic process
Gene Ontology
 GO:0019439 aromatic compound catabolic process
Gene Ontology
 GO:0019438 aromatic compound biosynthetic process
Gene Ontology
 GO:0018130 heterocycle biosynthetic process
Gene Ontology
 GO:0016818 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
Gene Ontology
 GO:0016817 hydrolase activity, acting on acid anhydrides
Gene Ontology
 GO:0016787 hydrolase activity
Gene Ontology
 GO:0016462 pyrophosphatase activity
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009394 2'-deoxyribonucleotide metabolic process
Gene Ontology
 GO:0009265 2'-deoxyribonucleotide biosynthetic process
Gene Ontology
 GO:0009264 deoxyribonucleotide catabolic process
Gene Ontology
 GO:0009263 deoxyribonucleotide biosynthetic process
Gene Ontology
 GO:0009262 deoxyribonucleotide metabolic process
Gene Ontology
 GO:0009223 pyrimidine deoxyribonucleotide catabolic process
Gene Ontology
 GO:0009221 pyrimidine deoxyribonucleotide biosynthetic process
Gene Ontology
 GO:0009219 pyrimidine deoxyribonucleotide metabolic process
Gene Ontology
 GO:0009213 pyrimidine deoxyribonucleoside triphosphate catabolic process
Gene Ontology
 GO:0009211 pyrimidine deoxyribonucleoside triphosphate metabolic process
Gene Ontology
 GO:0009204 deoxyribonucleoside triphosphate catabolic process
Gene Ontology
 GO:0009200 deoxyribonucleoside triphosphate metabolic process
Gene Ontology
 GO:0009177 pyrimidine deoxyribonucleoside monophosphate biosynthetic process
Gene Ontology
 GO:0009176 pyrimidine deoxyribonucleoside monophosphate metabolic process
Gene Ontology
 GO:0009166 nucleotide catabolic process
Gene Ontology
 GO:0009165 nucleotide biosynthetic process
Gene Ontology
 GO:0009162 deoxyribonucleoside monophosphate metabolic process
Gene Ontology
 GO:0009157 deoxyribonucleoside monophosphate biosynthetic process
Gene Ontology
 GO:0009149 pyrimidine nucleoside triphosphate catabolic process
Gene Ontology
 GO:0009147 pyrimidine nucleoside triphosphate metabolic process
Gene Ontology
 GO:0009143 nucleoside triphosphate catabolic process
Gene Ontology
 GO:0009141 nucleoside triphosphate metabolic process
Gene Ontology
 GO:0009130 pyrimidine nucleoside monophosphate biosynthetic process
Gene Ontology
 GO:0009129 pyrimidine nucleoside monophosphate metabolic process
Gene Ontology
 GO:0009124 nucleoside monophosphate biosynthetic process
Gene Ontology
 GO:0009123 nucleoside monophosphate metabolic process
Gene Ontology
 GO:0009117 nucleotide metabolic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0009056 catabolic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006796 phosphate-containing compound metabolic process
Gene Ontology
 GO:0006793 phosphorus metabolic process
Gene Ontology
 GO:0006753 nucleoside phosphate metabolic process
Gene Ontology
 GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
 GO:0006244 pyrimidine nucleotide catabolic process
Gene Ontology
 GO:0006226 dUMP biosynthetic process
Gene Ontology
 GO:0006221 pyrimidine nucleotide biosynthetic process
Gene Ontology
 GO:0006220 pyrimidine nucleotide metabolic process
Gene Ontology
 GO:0006139 nucleobase-containing compound metabolic process
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0004170 dUTP diphosphatase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0000287 magnesium ion binding
Eggnog Protein
 EP:dut
Eggnog Ortholog
 EO:COG0756
Eggnog Description
 ED:This enzyme is involved in nucleotide metabolism it produces dUMP
EC Number
 EC:3.6.1.23 dUTP diphosphatase; DUT (gene name); deoxyuridine-triphosphatase; dUTPase; dUTP pyrophosphatase; desoxyuridine 5'-triphosphate nucleotidohydrolase; desoxyuridine 5'-triphosphatase kornec00240kornec00983kornec01100
Gene Product
 dUTP diphosphatase
Gene Code
 dut

Occurs in the following pathway maps:

Pathway Description
kornec00240 Pyrimidine metabolism
kornec00983 Drug metabolism - other enzymes
kornec01100 Metabolic pathways

Sequences

Nucleotide sequence (GC-content: 70.9 %):

ATGACCCCCGAGATCGAGATCGCGACCACCGTGGCGGCGGGAGCCACCGCCCCGCACTACGCGATGCCCGGGGACGCCGGCGCCGACCTGTCGACCACCGTCGAGGTCGATCTGGCCCCGGGCCGGCGGCTCATGGTGCCCACCGGGGTTCGGGTTGCCATCCCCGACGGGTACGTCGGGTTCATCAACCCGCGCTCCGGACTGGCGGCGCGCACCGGACTCAGCATCGTCAACACCCCCGGCACCATCGACTCCGGGTACCGCGGGGAGCTACGGATCCTGCTCATCAACACCGATCCCAGCCATCCGATCCACCTGGACGCCGGGGACCGGATCGCCCAGCTCGTCATCATCCCGGTGGTCCGGGCCCGGTTCGTTCCGGTGGAGGAGCTTCCGCCGTCATCCCGGGGGGAGTCCGGGTACGGGTCCACCGGTGTGGCATGA

Protein sequence:

MTPEIEIATTVAAGATAPHYAMPGDAGADLSTTVEVDLAPGRRLMVPTGVRVAIPDGYVGFINPRSGLAARTGLSIVNTPGTIDSGYRGELRILLINTDPSHPIHLDAGDRIAQLVIIPVVRARFVPVEELPPSSRGESGYGSTGVA

GenBank Info

gene - dut
locus_tag - FAM19038-p1-1.1_002414
EC_number - 3.6.1.23
inference - COORDINATES: similar to AA sequence:RefSeq:WP_011756347.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - dUTP diphosphatase
protein_id - extdb:FAM19038-p1-1.1_002414

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

FAM19038-p1-1.1_002413
FAM19038-p1-1.1_002415