Annotations

Type Name Description Pathways
Gene Product
recombinase RecA
Gene Code
recA
Ortholog
N0.HOG0001088 recombinase RecA
KEGG gene
K03553 recA; recombination protein RecA kornec03440
Gene Ontology
GO:1901363 heterocyclic compound binding
Gene Ontology
GO:1901360 organic cyclic compound metabolic process
Gene Ontology
GO:1901265 nucleoside phosphate binding
Gene Ontology
GO:0140097 catalytic activity, acting on DNA
Gene Ontology
GO:0097367 carbohydrate derivative binding
Gene Ontology
GO:0097159 organic cyclic compound binding
Gene Ontology
GO:0090305 nucleic acid phosphodiester bond hydrolysis
Gene Ontology
GO:0090304 nucleic acid metabolic process
Gene Ontology
GO:0071704 organic substance metabolic process
Gene Ontology
GO:0071496 cellular response to external stimulus
Gene Ontology
GO:0051716 cellular response to stimulus
Gene Ontology
GO:0050896 response to stimulus
Gene Ontology
GO:0046914 transition metal ion binding
Gene Ontology
GO:0046872 metal ion binding
Gene Ontology
GO:0046677 response to antibiotic
Gene Ontology
GO:0046483 heterocycle metabolic process
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044444 obsolete cytoplasmic part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044260 cellular macromolecule metabolic process
Gene Ontology
GO:0044238 primary metabolic process
Gene Ontology
GO:0044237 cellular metabolic process
Gene Ontology
GO:0043170 macromolecule metabolic process
Gene Ontology
GO:0043169 cation binding
Gene Ontology
GO:0043168 anion binding
Gene Ontology
GO:0043167 ion binding
Gene Ontology
GO:0042623 -
Gene Ontology
GO:0042221 response to chemical
Gene Ontology
GO:0042148 strand invasion
Gene Ontology
GO:0036094 small molecule binding
Gene Ontology
GO:0035639 purine ribonucleoside triphosphate binding
Gene Ontology
GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
GO:0033554 cellular response to stress
Gene Ontology
GO:0032559 adenyl ribonucleotide binding
Gene Ontology
GO:0032555 purine ribonucleotide binding
Gene Ontology
GO:0032553 ribonucleotide binding
Gene Ontology
GO:0031668 cellular response to extracellular stimulus
Gene Ontology
GO:0030554 adenyl nucleotide binding
Gene Ontology
GO:0030145 manganese ion binding
Gene Ontology
GO:0017111 ribonucleoside triphosphate phosphatase activity
Gene Ontology
GO:0017076 purine nucleotide binding
Gene Ontology
GO:0016887 ATP hydrolysis activity
Gene Ontology
GO:0016818 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
Gene Ontology
GO:0016817 hydrolase activity, acting on acid anhydrides
Gene Ontology
GO:0016788 hydrolase activity, acting on ester bonds
Gene Ontology
GO:0016787 hydrolase activity
Gene Ontology
GO:0016462 pyrophosphatase activity
Gene Ontology
GO:0009991 response to extracellular stimulus
Gene Ontology
GO:0009987 cellular process
Gene Ontology
GO:0009650 UV protection
Gene Ontology
GO:0009628 response to abiotic stimulus
Gene Ontology
GO:0009605 response to external stimulus
Gene Ontology
GO:0009432 SOS response
Gene Ontology
GO:0009416 response to light stimulus
Gene Ontology
GO:0009411 response to UV
Gene Ontology
GO:0009314 response to radiation
Gene Ontology
GO:0008152 metabolic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0008144 obsolete drug binding
Gene Ontology
GO:0008094 ATP-dependent activity, acting on DNA
Gene Ontology
GO:0007154 cell communication
Gene Ontology
GO:0006974 cellular response to DNA damage stimulus
Gene Ontology
GO:0006950 response to stress
Gene Ontology
GO:0006807 nitrogen compound metabolic process
Gene Ontology
GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
GO:0006310 DNA recombination
Gene Ontology
GO:0006281 DNA repair
Gene Ontology
GO:0006259 DNA metabolic process
Gene Ontology
GO:0006139 nucleobase-containing compound metabolic process
Gene Ontology
GO:0005829 cytosol
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0005524 ATP binding
Gene Ontology
GO:0005488 binding
Gene Ontology
GO:0004536 deoxyribonuclease activity
Gene Ontology
GO:0004520 endodeoxyribonuclease activity
Gene Ontology
GO:0004519 endonuclease activity
Gene Ontology
GO:0004518 nuclease activity
Gene Ontology
GO:0003824 catalytic activity
Gene Ontology
GO:0003697 single-stranded DNA binding
Gene Ontology
GO:0003677 DNA binding
Gene Ontology
GO:0003676 nucleic acid binding
Gene Ontology
GO:0003674 molecular_function
Gene Ontology
GO:0000725 recombinational repair
Gene Ontology
GO:0000287 magnesium ion binding
Gene Ontology
GO:0000166 nucleotide binding
Gene Ontology
GO:0000150 DNA strand exchange activity
Eggnog Protein
EP:recA
Eggnog Ortholog
EO:COG0468
Eggnog Description
ED:Can catalyze the hydrolysis of ATP in the presence of single-stranded DNA

Occurs in the following pathway maps:

Pathway Description
kornec03440 Homologous recombination

Sequences

Nucleotide sequence (GC-content: 64.8 %):

ATGCCCGTCAAGGATCGTGAGAAGGCCCTCGAGGCCGCCATCGACCAGATCGACAAGCAGTACGGCAAGGGATCGGTGATGCGGCTGGGGGAGCGCGAGACGGTCAAGATCCCGGCCATCCCGACCGGCTCGGTCGCCCTGGACGTCGCCCTGGGCGTCGGCGGCCTGCCGCGCGGCAGGATCGTGGAGATCTACGGACCGGAGTCCAGCGGCAAGACGACGGTCGCGCTGCACGCGATCGCCAACGCCCAGGCCGAGGGCGGAGTGTGCGCCTTCATCGACGCCGAGCACGCACTGGATCCCGAGTACGCCAAGAACCTCGGGGTCGACACCGACAACCTGCTGATCAGCCAGCCCGACAATGGTGAGCAGGCCCTGGAGATCGCCGACACCCTGGTGCGATCGGGTGCCCTCGAACTCATCGTCATTGACTCGGTCGCGGCGCTGACCCCCAAGGCCGAGATCGAGGGTGACATGGGCGACTCCCATGTCGGTCTGCAGGCGCGCCTGATGAGTCAGGCGCTGCGCAAGATGACCGGCGCACTCAATGCGGCGGGAACCACCGCCATCTTCATCAACCAGCTGCGCGAGAAGATCGGCGTGATGTTCGGCAGCCCCGAGACGACCACCGGCGGTCGGGCGCTGAAGTTCTACGCATCGGTGCGACTCGACGTCCGAAGGATCCAGACCCTCAAGGACGGCGACGAGATGGTCGGCAACCGCACCCGGGTGAAGGTCGCCAAGAACAAGGTCGCACCGCCCTTCAAGCAGGCTGAGTTCGACATCCTCTACGGCCAGGGCATCTCCCGTGAGGGCAGCCTCATCGACATGGGGGTGGATCTCAACATCATTCGCAAGTCCGGCTCCTGGTACACCTACAAGGAGTCCGAGCAGCTGGGACAGGGCAAGGAGAATGTCCGCAAATTCCTCAAGGAGAACCCCGATATCGCCAAGGAGATCGAGTCGAGGATCCGCACCGAGATGGGGCTGGACCAGCCTGCCGACGATGAGGTTCCGGCTGAGGTGGACCCGAAGACCGGGGAGGTGATGTTCTGA

Protein sequence:

MPVKDREKALEAAIDQIDKQYGKGSVMRLGERETVKIPAIPTGSVALDVALGVGGLPRGRIVEIYGPESSGKTTVALHAIANAQAEGGVCAFIDAEHALDPEYAKNLGVDTDNLLISQPDNGEQALEIADTLVRSGALELIVIDSVAALTPKAEIEGDMGDSHVGLQARLMSQALRKMTGALNAAGTTAIFINQLREKIGVMFGSPETTTGGRALKFYASVRLDVRRIQTLKDGDEMVGNRTRVKVAKNKVAPPFKQAEFDILYGQGISREGSLIDMGVDLNIIRKSGSWYTYKESEQLGQGKENVRKFLKENPDIAKEIESRIRTEMGLDQPADDEVPAEVDPKTGEVMF

GenBank Info

gene - recA
locus_tag - FAM19038-p1-1.1_002451
inference - COORDINATES: similar to AA sequence:RefSeq:WP_015070244.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - recombinase RecA
protein_id - extdb:FAM19038-p1-1.1_002451

Gene Locus

Located on scaffold FAM19038-p1-1_scf1


Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol

FAM19038-p1-1.1_002450
FAM19038-p1-1.1_002452