update range to 10000 bp
locus tag: FAM19038-p1-1.1_002454 genome: FAM19038-p1-1.1
species: Acidipropionibacterium jensenii taxid: 1749

Annotations

Type Name Description Pathways
Ortholog
 N0.HOG0002324 helix-turn-helix transcriptional regulator
Gene Product
 helix-turn-helix transcriptional regulator
Gene Ontology
 GO:2001141 regulation of RNA biosynthetic process
Gene Ontology
 GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
 GO:1903508 positive regulation of nucleic acid-templated transcription
Gene Ontology
 GO:1903506 regulation of nucleic acid-templated transcription
Gene Ontology
 GO:1903362 -
Gene Ontology
 GO:1903050 regulation of proteolysis involved in protein catabolic process
Gene Ontology
 GO:1902882 regulation of response to oxidative stress
Gene Ontology
 GO:1902680 positive regulation of RNA biosynthetic process
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0090062 regulation of trehalose metabolic process
Gene Ontology
 GO:0085016 dormancy exit of symbiont in host
Gene Ontology
 GO:0080134 regulation of response to stress
Gene Ontology
 GO:0080090 regulation of primary metabolic process
Gene Ontology
 GO:0075136 response to host
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0062012 regulation of small molecule metabolic process
Gene Ontology
 GO:0061136 regulation of proteasomal protein catabolic process
Gene Ontology
 GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
 GO:0052572 response to host immune response
Gene Ontology
 GO:0052564 -
Gene Ontology
 GO:0052562 suppression by symbiont of host immune response
Gene Ontology
 GO:0052561 -
Gene Ontology
 GO:0052553 modulation by symbiont of host immune response
Gene Ontology
 GO:0052552 -
Gene Ontology
 GO:0052309 -
Gene Ontology
 GO:0052306 -
Gene Ontology
 GO:0052261 -
Gene Ontology
 GO:0052255 -
Gene Ontology
 GO:0052200 response to host defenses
Gene Ontology
 GO:0052173 response to defenses of other organism
Gene Ontology
 GO:0052170 suppression by symbiont of host innate immune response
Gene Ontology
 GO:0052167 modulation by symbiont of host innate immune response
Gene Ontology
 GO:0052037 -
Gene Ontology
 GO:0052031 modulation by symbiont of host defense response
Gene Ontology
 GO:0051833 -
Gene Ontology
 GO:0051832 -
Gene Ontology
 GO:0051817 obsolete modulation of process of other organism involved in symbiotic interaction
Gene Ontology
 GO:0051716 cellular response to stimulus
Gene Ontology
 GO:0051707 response to other organism
Gene Ontology
 GO:0051704 obsolete multi-organism process
Gene Ontology
 GO:0051701 biological process involved in interaction with host
Gene Ontology
 GO:0051254 positive regulation of RNA metabolic process
Gene Ontology
 GO:0051252 regulation of RNA metabolic process
Gene Ontology
 GO:0051246 regulation of protein metabolic process
Gene Ontology
 GO:0051173 positive regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0050896 response to stimulus
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0050777 negative regulation of immune response
Gene Ontology
 GO:0050776 regulation of immune response
Gene Ontology
 GO:0048585 negative regulation of response to stimulus
Gene Ontology
 GO:0048583 regulation of response to stimulus
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048519 negative regulation of biological process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0045935 positive regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0045893 positive regulation of DNA-templated transcription
Gene Ontology
 GO:0045824 negative regulation of innate immune response
Gene Ontology
 GO:0045088 regulation of innate immune response
Gene Ontology
 GO:0044419 biological process involved in interspecies interaction between organisms
Gene Ontology
 GO:0044414 suppression of host defenses by symbiont
Gene Ontology
 GO:0044413 -
Gene Ontology
 GO:0044403 biological process involved in symbiotic interaction
Gene Ontology
 GO:0044119 -
Gene Ontology
 GO:0044117 -
Gene Ontology
 GO:0044116 -
Gene Ontology
 GO:0044115 -
Gene Ontology
 GO:0044114 development of symbiont in host
Gene Ontology
 GO:0044111 formation of structure involved in a symbiotic process
Gene Ontology
 GO:0044110 obsolete growth involved in symbiotic interaction
Gene Ontology
 GO:0044003 modulation by symbiont of host process
Gene Ontology
 GO:0043620 regulation of DNA-templated transcription in response to stress
Gene Ontology
 GO:0043565 sequence-specific DNA binding
Gene Ontology
 GO:0043207 response to external biotic stimulus
Gene Ontology
 GO:0042176 regulation of protein catabolic process
Gene Ontology
 GO:0040007 growth
Gene Ontology
 GO:0035821 modulation of process of another organism
Gene Ontology
 GO:0033554 cellular response to stress
Gene Ontology
 GO:0032502 developmental process
Gene Ontology
 GO:0032268 regulation of cellular protein metabolic process
Gene Ontology
 GO:0031348 negative regulation of defense response
Gene Ontology
 GO:0031347 regulation of defense response
Gene Ontology
 GO:0031329 regulation of cellular catabolic process
Gene Ontology
 GO:0031328 positive regulation of cellular biosynthetic process
Gene Ontology
 GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
 GO:0031325 positive regulation of cellular metabolic process
Gene Ontology
 GO:0031323 regulation of cellular metabolic process
Gene Ontology
 GO:0030162 regulation of proteolysis
Gene Ontology
 GO:0022611 dormancy process
Gene Ontology
 GO:0019222 regulation of metabolic process
Gene Ontology
 GO:0019219 regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0019217 regulation of fatty acid metabolic process
Gene Ontology
 GO:0019216 regulation of lipid metabolic process
Gene Ontology
 GO:0010675 regulation of cellular carbohydrate metabolic process
Gene Ontology
 GO:0010628 positive regulation of gene expression
Gene Ontology
 GO:0010604 positive regulation of macromolecule metabolic process
Gene Ontology
 GO:0010565 regulation of cellular ketone metabolic process
Gene Ontology
 GO:0010557 positive regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010468 regulation of gene expression
Gene Ontology
 GO:0010447 response to acidic pH
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009894 regulation of catabolic process
Gene Ontology
 GO:0009893 positive regulation of metabolic process
Gene Ontology
 GO:0009891 positive regulation of biosynthetic process
Gene Ontology
 GO:0009889 regulation of biosynthetic process
Gene Ontology
 GO:0009628 response to abiotic stimulus
Gene Ontology
 GO:0009607 response to biotic stimulus
Gene Ontology
 GO:0009605 response to external stimulus
Gene Ontology
 GO:0009408 response to heat
Gene Ontology
 GO:0009268 response to pH
Gene Ontology
 GO:0009266 response to temperature stimulus
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006979 response to oxidative stress
Gene Ontology
 GO:0006950 response to stress
Gene Ontology
 GO:0006355 regulation of DNA-templated transcription
Gene Ontology
 GO:0006109 regulation of carbohydrate metabolic process
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0003677 DNA binding
Gene Ontology
 GO:0003676 nucleic acid binding
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0002683 negative regulation of immune system process
Gene Ontology
 GO:0002682 regulation of immune system process
Eggnog Protein
 EP:clgR
Eggnog Ortholog
 EO:COG1396
Eggnog Description
 ED:Helix-turn-helix XRE-family like proteins

Sequences

Nucleotide sequence (GC-content: 65.6 %):

ATGAAGGCTGCGCTGCTACGAGAAATGCTGGGTGAGGCGCTCCGGGAGCAGAGGTTCGCCCAGGGGCGAACGCTGCGCGAGGTGTCATCGGGGGCCAGGGTGTCGCTTGGCTACCTGTCCGAGGTGGAGAGGGGCCAGAAGGAGGCCTCCAGCGAACTGATTCTCGCCATCTGCACCGCTCTCGAGCTTCCGCAGTCTGAACTCATGAGGACCGTCAGCGAGAAGCTGCTGAAGGCCGAGACGAAGGCCGAGCGCCAGGTCGGCGCGGCAGCCTGA

Protein sequence:

MKAALLREMLGEALREQRFAQGRTLREVSSGARVSLGYLSEVERGQKEASSELILAICTALELPQSELMRTVSEKLLKAETKAERQVGAAA

GenBank Info

locus_tag - FAM19038-p1-1.1_002454
inference - COORDINATES: similar to AA sequence:RefSeq:WP_015070241.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - helix-turn-helix transcriptional regulator
protein_id - extdb:FAM19038-p1-1.1_002454

Gene Locus

Located on scaffold FAM19038-p1-1_scf1

FAM19038-p1-1.1_002453
FAM19038-p1-1.1_002455