update range to 10000 bp
locus tag: FAM19471-i1-1.1_000310 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
KEGG reaction
 R11671 Malonyl-CoA + Acetyl-CoA <=> Dodecanoyl-[acyl-carrier protein] kornec00333kornec01110
KEGG reaction
 R10120 3-hydroxypimeloyl-[acp]-methyl-ester:NADP+ oxidoreductase; 3-Ketopimeloyl-[acp] methyl ester + NADPH + H+ <=> 3-Hydroxypimeloyl-[acp] methyl ester + NADP+ kornec00780kornec01100kornec01240
KEGG reaction
 R10116 3-hydroxyglutaryl-[acp]-methyl-ester:NADP+ oxidoreductase; 3-Ketoglutaryl-[acp] methyl ester + NADPH + H+ <=> 3-Hydroxyglutaryl-[acp] methyl ester + NADP+ kornec00780kornec01100kornec01240
KEGG reaction
 R07763 3-Oxostearoyl-[acp] + NADPH + H+ <=> (3R)-3-Hydroxyoctadecanoyl-[acyl-carrier protein] + NADP+ kornec00061kornec01212
KEGG reaction
 R07759 3-hydroxyoctadecanoyl-CoA:NADP+ oxidoreductase; 3-Oxostearoyl-CoA + NADPH + H+ <=> 3-Hydroxyoctadecanoyl-CoA + NADP+ kornec01040kornec01212
KEGG reaction
 R04964 (3R)-3-hydroxydodecanoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxydodecanoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxododecanoyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
KEGG reaction
 R04953 (3R)-3-hydroxyhexanoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxyhexanoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxohexanoyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
KEGG reaction
 R04566 (3R)-3-hydroxytetradecanoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxytetradecanoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxotetradecanoyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
KEGG reaction
 R04543 (3R)-3-hydroxypalmitoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxypalmitoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxohexadecanoyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
KEGG reaction
 R04536 (3R)-3-hydroxyoctanoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxyoctanoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxooctanoyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
KEGG reaction
 R04534 (3R)-3-hydroxydecanoyl-[acyl-carrier-protein]:NADP+ oxidoreductase; (3R)-3-Hydroxydecanoyl-[acyl-carrier protein] + NADP+ <=> 3-Oxodecanoyl-[acp] + NADPH kornec00061kornec01100kornec01212
KEGG reaction
 R04533 (3R)-3-hydroxybutanoyl-[acyl-carrier protein]:NADP+ oxidoreductase; (3R)-3-Hydroxybutanoyl-[acyl-carrier protein] + NADP+ <=> Acetoacetyl-[acp] + NADPH + H+ kornec00061kornec01100kornec01212
Ortholog
 N0.HOG0000471 3-oxoacyl-[acyl-carrier-protein] reductase
KEGG gene
 K00059 fabG, OAR1; 3-oxoacyl-[acyl-carrier protein] reductase [EC:1.1.1.100] kornec00061kornec00333kornec00780kornec01100kornec01110kornec01212kornec01240
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:1901265 nucleoside phosphate binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0072330 monocarboxylic acid biosynthetic process
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0055114 obsolete oxidation-reduction process
Gene Ontology
 GO:0050662 obsolete coenzyme binding
Gene Ontology
 GO:0050661 NADP binding
Gene Ontology
 GO:0048037 obsolete cofactor binding
Gene Ontology
 GO:0046394 carboxylic acid biosynthetic process
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044255 cellular lipid metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043436 oxoacid metabolic process
Gene Ontology
 GO:0036094 small molecule binding
Gene Ontology
 GO:0032787 monocarboxylic acid metabolic process
Gene Ontology
 GO:0030497 fatty acid elongation
Gene Ontology
 GO:0019752 carboxylic acid metabolic process
Gene Ontology
 GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups
Gene Ontology
 GO:0016746 acyltransferase activity
Gene Ontology
 GO:0016740 transferase activity
Gene Ontology
 GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
Gene Ontology
 GO:0016614 oxidoreductase activity, acting on CH-OH group of donors
Gene Ontology
 GO:0016491 oxidoreductase activity
Gene Ontology
 GO:0016053 organic acid biosynthetic process
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008610 lipid biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006633 fatty acid biosynthetic process
Gene Ontology
 GO:0006631 fatty acid metabolic process
Gene Ontology
 GO:0006629 lipid metabolic process
Gene Ontology
 GO:0006082 organic acid metabolic process
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0004316 3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity
Gene Ontology
 GO:0004312 fatty acid synthase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0000166 nucleotide binding
Eggnog Protein
 EP:fabG
Eggnog Ortholog
 EO:COG1028
Eggnog Description
 ED:reductase
EC Number
 EC:1.1.1.100 3-oxoacyl-[acyl-carrier-protein] reductase; beta-ketoacyl-[acyl-carrier protein](ACP) reductase; beta-ketoacyl acyl carrier protein (ACP) reductase; beta-ketoacyl reductase; beta-ketoacyl thioester reductase; beta-ketoacyl-ACP reductase; beta-ketoacyl-acyl carrier protein reductase; 3-ketoacyl acyl carrier protein reductase; NADPH-specific 3-oxoacyl-[acylcarrier protein]reductase; 3-oxoacyl-[ACP]reductase; (3R)-3-hydroxyacyl-[acyl-carrier-protein]:NADP+ oxidoreductase kornec00061kornec00780kornec01100
Gene Product
 3-oxoacyl-ACP reductase FabG

Occurs in the following pathway maps:

Pathway Description
kornec00061 Fatty acid biosynthesis
kornec00333 Prodigiosin biosynthesis
kornec00780 Biotin metabolism
kornec01040 Biosynthesis of unsaturated fatty acids
kornec01100 Metabolic pathways
kornec01110 Biosynthesis of secondary metabolites
kornec01212 Fatty acid metabolism
kornec01240 Biosynthesis of cofactors

Sequences

Nucleotide sequence (GC-content: 52.9 %):

ATGGAACTCAAGGATAAGGTTGTCTTTATTACCGGTTCAACCCGGGGAATTGGGGCGGCAACCGCCCTGGCCTTTGCTAAGCAGGGGAGCCGCTTGGTGTTAAACGGACGCCACGACCTCGATGATGATATGAAGCAAAAGCTAGAAGAAGCTGGCGCCGATTACAAGTTCTTGATTGGTGACGTAGCTGATGAAGAATCGGTGGCTCAATTAGCCAAGGAGGCTTGGGATGCCTACGGGCACATCGACGTCTTGGTTAATAACGCCGGGATCACCCGCGACCGTCTGATTGGCGGAATGAAGGTAGCAGACTTTGACCAGGTGATCGCCGTTAACTTGCGGGGACCGTTTTTACTGATTAAGGCCTTGATCAAGAAGTTTAACAAGCAACGCTCTGGTGCCATTATCAACCTGGCTAGCGTAGTTGGATTACACGGTAATGCCGGGCAGGCCAACTACTCGGCAAGTAAGGCCGGCATCGTTGGCTTAACCAAGACGGTGGCTCGTGAAGGGGCCATGCGGGGAATTCGTTGCAACGCCATTGCACCCGGGATGATTGCTAGCGACATGACGGCCGCCCTTTCCGAACGGGTTCAAGAGGGCATCGTGGAACAAATTCCGCTTAAGCGACTAGGAACGGTCGATGAAGTGGCACAATGCGCAATCTTCTTGGCGCAAAATGATTACGTTACCGGCCAAGTATTGGTCGTTGACGGTGGGATGACGATTTAG

Protein sequence:

MELKDKVVFITGSTRGIGAATALAFAKQGSRLVLNGRHDLDDDMKQKLEEAGADYKFLIGDVADEESVAQLAKEAWDAYGHIDVLVNNAGITRDRLIGGMKVADFDQVIAVNLRGPFLLIKALIKKFNKQRSGAIINLASVVGLHGNAGQANYSASKAGIVGLTKTVAREGAMRGIRCNAIAPGMIASDMTAALSERVQEGIVEQIPLKRLGTVDEVAQCAIFLAQNDYVTGQVLVVDGGMTI

GenBank Info

locus_tag - FAM19471-i1-1.1_000310
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003682544.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - 3-oxoacyl-ACP reductase FabG
protein_id - extdb:FAM19471-i1-1.1_000310

Gene Locus

Located on scaffold FAM19471-i1-1_scf3

FAM19471-i1-1.1_000309
FAM19471-i1-1.1_000311