update range to 10000 bp
locus tag: FAM19471-i1-1.1_000323 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
Ortholog
 N0.HOG0000509 chaperonin GroEL
KEGG gene
 K04077 groEL, HSPD1; chaperonin GroEL kornec03018kornec04212kornec04940kornec05134kornec05152
Gene Code
 groL
Gene Ontology
 GO:2001065 mannan binding
Gene Ontology
 GO:2000484 -
Gene Ontology
 GO:2000482 -
Gene Ontology
 GO:1990220 GroEL-GroES complex
Gene Ontology
 GO:1904951 positive regulation of establishment of protein localization
Gene Ontology
 GO:1903532 positive regulation of secretion by cell
Gene Ontology
 GO:1903530 regulation of secretion by cell
Gene Ontology
 GO:0101031 chaperone complex
Gene Ontology
 GO:0098743 cell aggregation
Gene Ontology
 GO:0098630 aggregation of unicellular organisms
Gene Ontology
 GO:0090087 regulation of peptide transport
Gene Ontology
 GO:0070201 regulation of establishment of protein localization
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0061077 chaperone-mediated protein folding
Gene Ontology
 GO:0051704 obsolete multi-organism process
Gene Ontology
 GO:0051240 positive regulation of multicellular organismal process
Gene Ontology
 GO:0051239 regulation of multicellular organismal process
Gene Ontology
 GO:0051223 regulation of protein transport
Gene Ontology
 GO:0051222 positive regulation of protein transport
Gene Ontology
 GO:0051082 unfolded protein binding
Gene Ontology
 GO:0051050 positive regulation of transport
Gene Ontology
 GO:0051049 regulation of transport
Gene Ontology
 GO:0051047 positive regulation of secretion
Gene Ontology
 GO:0051046 regulation of secretion
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0050715 -
Gene Ontology
 GO:0050714 positive regulation of protein secretion
Gene Ontology
 GO:0050708 regulation of protein secretion
Gene Ontology
 GO:0050707 -
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0046812 host cell surface binding
Gene Ontology
 GO:0044764 obsolete multi-organism cellular process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044445 obsolete cytosolic part
Gene Ontology
 GO:0044444 obsolete cytoplasmic part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044183 protein folding chaperone
Gene Ontology
 GO:0032991 protein-containing complex
Gene Ontology
 GO:0032880 regulation of protein localization
Gene Ontology
 GO:0032879 regulation of localization
Gene Ontology
 GO:0032757 positive regulation of interleukin-8 production
Gene Ontology
 GO:0032677 regulation of interleukin-8 production
Gene Ontology
 GO:0030247 polysaccharide binding
Gene Ontology
 GO:0030246 carbohydrate binding
Gene Ontology
 GO:0016465 chaperonin ATPase complex
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009986 cell surface
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006458 'de novo' protein folding
Gene Ontology
 GO:0006457 protein folding
Gene Ontology
 GO:0005829 cytosol
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005515 protein binding
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0002793 positive regulation of peptide secretion
Gene Ontology
 GO:0002791 regulation of peptide secretion
Gene Ontology
 GO:0001871 obsolete pattern binding
Gene Ontology
 GO:0001819 positive regulation of cytokine production
Gene Ontology
 GO:0001817 regulation of cytokine production
Eggnog Protein
 EP:groL
Eggnog Ortholog
 EO:COG0459
Eggnog Description
 ED:Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions
Gene Product
 chaperonin GroEL

Occurs in the following pathway maps:

Pathway Description
kornec03018 RNA degradation
kornec04212 Longevity regulating pathway - worm
kornec04940 Type I diabetes mellitus
kornec05134 Legionellosis
kornec05152 Tuberculosis

Sequences

Nucleotide sequence (GC-content: 52.8 %):

ATGGCAAAGGAATTAAAGTTCTCAGAAGACGCACGGAGCGCAATGCTGCGTGGGGTTAATAAGTTAGCAGACACCGTCAAGACGACGATTGGGCCAAAGGGACGTAACGTGGTGTTGGAACAAAGTTACGGCTCCCCGACGATCACTAACGACGGGGTAACGATCGCTAAGAGCATTGAATTAGAAGACCACTTCGAAAACATGGGGGCTAAGCTGGTTTCCGAAGTTGCTTCTAAGACTAACGACATTGCCGGGGACGGGACCACGACGGCCACTGTTTTAACCCAAGCAATTGTGACCGAAGGAATGAAGAACGTGACCGCCGGCGCTAACCCAGTGGGCATTCGGCGCGGGATTGAAAAGGCGACGGCCGCAGCCGTTGAAGGCCTGAAAAAGATGAGCCACGACGTTAAGACCAAGGACGACATCGCTCAAATCGCCTCCATTTCCGCTGCTAACAAGGAAGTTGGTAAGTTGATCGCCGACGCCATGGAAAAGGTTGGTAACGACGGGGTCATCACGATTGAAGATTCCCGTGGGGTTGATACTAGCGTTGACGTGGTTGAAGGGATGAGCTTTGACCGTGGTTACATGTCCCAATACATGGTAACCGACAACGACAAGATGGAAGCCAACTTGGACAACCCGTACGTTTTGATTACGGACAAGAAGATCTCTAACATTCAAGACATCTTGCCACTACTCCAATCTGTTGTTCAAGAAGGGCGCGCCCTGTTAATCATTGCTGATGACATCACTGGTGAAGCACTGCCAACCCTTGTGTTGAACAAGATTCGGGGAACCTTCAACGTAGTTGCCGTTAAGGCCCCAGGCTTTGGTGACCGTCGCAAGGCTCAATTGGAAGACATTGCCGTTCTGACTGGTGGGACCGTGATTTCCGACGACCTTGGTATGCAATTGAAGGACGCTACGATTGACCAACTTGGTTCTGCTAACAAGGTTACGATAACCAAGGACGCTACCACGATCGTTGATGGCAGTGGCAACAAGGAAGCCATTGCAGAACGGGTTGACCAAATCAAGAAGGCGATTGCCGAAACGACCTCTGACTTTGACAAGGAAAAGCTCCAAGAACGGCTCGCTAAGTTAGCCGGTGGGGTGGCCGTTGTTAAGGTTGGGGCCGCTACCGAAACCGAACTCAAGGAAAAGAAGTACCGGATCGAAGACGCCTTAAACGCCACCCGGGCCGCCGTGCAAGAAGGCTTTGTTCCTGGTGGTGGAACGGCACTGGTTAACGTTATCGCTGCCTTGGACGAAGTGGAAGCAGCCGCAACTGGCGACGAAGCAACCGGGATTAAGATTGTGAAGGCGGCTCTGGAAGCCCCAGTTCGTCAAATCGCCGAAAACGCCGGTTTGGAAGGTTCCGTGATCGTTAACCAGCTGAAGCAAGAAAAGCCGGGAGTTGGTTACAACGCCGCTGATGACAAGTTTGAAGACATGGTCGCTGCCGGAATTGTTGACCCAACTAAGGTCACCCGCTCGGCCCTGCAAAACGCAGCTTCCGTTTCCGCCCTCCTCTTGACGACGGAAGCCGTTGTTGCCGACAAGCCACAACCCGCTGACGCTGCACCACAAGCACCAGTAGCCGGTGGTATGGGCGGCATGATGTAA

Protein sequence:

MAKELKFSEDARSAMLRGVNKLADTVKTTIGPKGRNVVLEQSYGSPTITNDGVTIAKSIELEDHFENMGAKLVSEVASKTNDIAGDGTTTATVLTQAIVTEGMKNVTAGANPVGIRRGIEKATAAAVEGLKKMSHDVKTKDDIAQIASISAANKEVGKLIADAMEKVGNDGVITIEDSRGVDTSVDVVEGMSFDRGYMSQYMVTDNDKMEANLDNPYVLITDKKISNIQDILPLLQSVVQEGRALLIIADDITGEALPTLVLNKIRGTFNVVAVKAPGFGDRRKAQLEDIAVLTGGTVISDDLGMQLKDATIDQLGSANKVTITKDATTIVDGSGNKEAIAERVDQIKKAIAETTSDFDKEKLQERLAKLAGGVAVVKVGAATETELKEKKYRIEDALNATRAAVQEGFVPGGGTALVNVIAALDEVEAAATGDEATGIKIVKAALEAPVRQIAENAGLEGSVIVNQLKQEKPGVGYNAADDKFEDMVAAGIVDPTKVTRSALQNAASVSALLLTTEAVVADKPQPADAAPQAPVAGGMGGMM

GenBank Info

gene - groL
locus_tag - FAM19471-i1-1.1_000323
inference - COORDINATES: similar to AA sequence:RefSeq:WP_019251225.1
note - 60 kDa chaperone family; promotes refolding of misfolded polypeptides especially under stressful conditions; forms two stacked rings of heptamers to form a barrel-shaped 14mer; ends can be capped by GroES; misfolded proteins enter the barrel where they are refolded when GroES binds; Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - chaperonin GroEL
protein_id - extdb:FAM19471-i1-1.1_000323

Gene Locus

Located on scaffold FAM19471-i1-1_scf3

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol
SL-0310: GO:0009986 cell surface
FAM19471-i1-1.1_000322
FAM19471-i1-1.1_000324