update range to 10000 bp
locus tag: FAM19471-i1-1.1_000401 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
Ortholog
 N0.HOG0001210 GTPase Era
KEGG gene
 K03595 era, ERAL1; GTPase
Gene Product
 GTPase Era
Gene Ontology
 GO:2000113 negative regulation of cellular macromolecule biosynthetic process
Gene Ontology
 GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
 GO:2000104 negative regulation of DNA-templated DNA replication
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:1901265 nucleoside phosphate binding
Gene Ontology
 GO:0097367 carbohydrate derivative binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0090329 regulation of DNA-templated DNA replication
Gene Ontology
 GO:0080090 regulation of primary metabolic process
Gene Ontology
 GO:0071944 cell periphery
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
 GO:0051781 positive regulation of cell division
Gene Ontology
 GO:0051302 regulation of cell division
Gene Ontology
 GO:0051172 negative regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0051053 negative regulation of DNA metabolic process
Gene Ontology
 GO:0051052 regulation of DNA metabolic process
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0048523 negative regulation of cellular process
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048519 negative regulation of biological process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0045934 negative regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0043168 anion binding
Gene Ontology
 GO:0043167 ion binding
Gene Ontology
 GO:0036094 small molecule binding
Gene Ontology
 GO:0035639 purine ribonucleoside triphosphate binding
Gene Ontology
 GO:0032561 guanyl ribonucleotide binding
Gene Ontology
 GO:0032555 purine ribonucleotide binding
Gene Ontology
 GO:0032553 ribonucleotide binding
Gene Ontology
 GO:0032550 purine ribonucleoside binding
Gene Ontology
 GO:0032549 ribonucleoside binding
Gene Ontology
 GO:0032297 negative regulation of DNA-templated DNA replication initiation
Gene Ontology
 GO:0031327 negative regulation of cellular biosynthetic process
Gene Ontology
 GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
 GO:0031324 negative regulation of cellular metabolic process
Gene Ontology
 GO:0031323 regulation of cellular metabolic process
Gene Ontology
 GO:0030174 regulation of DNA-templated DNA replication initiation
Gene Ontology
 GO:0019222 regulation of metabolic process
Gene Ontology
 GO:0019219 regulation of nucleobase-containing compound metabolic process
Gene Ontology
 GO:0019003 GDP binding
Gene Ontology
 GO:0019001 guanyl nucleotide binding
Gene Ontology
 GO:0017111 ribonucleoside triphosphate phosphatase activity
Gene Ontology
 GO:0017076 purine nucleotide binding
Gene Ontology
 GO:0016818 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
Gene Ontology
 GO:0016817 hydrolase activity, acting on acid anhydrides
Gene Ontology
 GO:0016787 hydrolase activity
Gene Ontology
 GO:0016462 pyrophosphatase activity
Gene Ontology
 GO:0016020 membrane
Gene Ontology
 GO:0010605 negative regulation of macromolecule metabolic process
Gene Ontology
 GO:0010558 negative regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0009892 negative regulation of metabolic process
Gene Ontology
 GO:0009890 negative regulation of biosynthetic process
Gene Ontology
 GO:0009889 regulation of biosynthetic process
Gene Ontology
 GO:0008156 negative regulation of DNA replication
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006275 regulation of DNA replication
Gene Ontology
 GO:0005886 plasma membrane
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005525 GTP binding
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0003924 GTPase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0001883 purine nucleoside binding
Gene Ontology
 GO:0001882 nucleoside binding
Gene Ontology
 GO:0000166 nucleotide binding
Eggnog Protein
 EP:era
Eggnog Ortholog
 EO:COG1159
Eggnog Description
 ED:An essential GTPase that binds both GDP and GTP

Sequences

Nucleotide sequence (GC-content: 55.7 %):

ATGGATAATCCAAATTACAAGTCGGGCTTTGTGGCCCTGATCGGCCGGCCCAACGTCGGCAAGTCAACCCTGTTAAACTACATGGTCGGCCAAAAGGTGGCCATCATGAGCAACGTCGCCCAGACCACCCGGAACAAGATTCAGGGGATCTACACTAGCGATGAGGCCCAGATCGTCTTCATCGATACCCCGGGGATTCACAAGCCCCAAACCCGCCTGGGCGACTTTATGGAACGCTCGGCCCTGTCGGCCTTAGATGAAGTCGACGCCATTCTCTTCGTGGTACCGGCCAATGAAAAGCGGGGGGCCGGGGATAACTTCATCATTGAGCGCTTAAAGAAGGTGCAACAGCCGATCTACCTGGTCGTCAACAAGATCGATCAGGTTAACCCCAACGACTTACCGGACATCATCGCCCAATACGAAGGGGCGCTGCCGTTCAAAAAGGTCGTGCCGGTCTCGGCCTTGCAGGGAAACAACGTCAACACCCTGATTAACGACTTAGTGGACCAACTGCCGACCGGCCCGCAGTACTACCCAGCCGACCAGGTGTCCGACCACCCGGAACGGTTCGTGATTGCGGAAATGATTCGCGAAAAGGTCTTCTTAAATACCAGGGAGGAAGTGCCGCACTCGGTGGCGATTGACGTCACCTCGATCCAACGAGAAGACGATGAAACGATTCACGTCTCGGCCAACATTATCGTTGAACGCCCCGGCCAAAAGGGGATCATCATCGGCAAGGGCGGTTCGATGCTCAAAAAGATCGGCACCGCGGCCCGCCAAGACATTCAGGCCCTCTTAGGTGACAAGGTCTTCTTGCAGCTGTGGGTCAAGGTGGTGCCGGGCTGGCGCGATAAGTCGGCGATGTTAAAGGACTACGGTTACCGGCAAACGGATTACTAA

Protein sequence:

MDNPNYKSGFVALIGRPNVGKSTLLNYMVGQKVAIMSNVAQTTRNKIQGIYTSDEAQIVFIDTPGIHKPQTRLGDFMERSALSALDEVDAILFVVPANEKRGAGDNFIIERLKKVQQPIYLVVNKIDQVNPNDLPDIIAQYEGALPFKKVVPVSALQGNNVNTLINDLVDQLPTGPQYYPADQVSDHPERFVIAEMIREKVFLNTREEVPHSVAIDVTSIQREDDETIHVSANIIVERPGQKGIIIGKGGSMLKKIGTAARQDIQALLGDKVFLQLWVKVVPGWRDKSAMLKDYGYRQTDY

GenBank Info

locus_tag - FAM19471-i1-1.1_000401
inference - COORDINATES: similar to AA sequence:RefSeq:WP_019253440.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - GTPase Era
protein_id - extdb:FAM19471-i1-1.1_000401

Gene Locus

Located on scaffold FAM19471-i1-1_scf4

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0039: GO:0005886 plasma membrane
SL-0162: GO:0016020 membrane
FAM19471-i1-1.1_000400
FAM19471-i1-1.1_000402