update range to 10000 bp
locus tag: FAM19471-i1-1.1_000680 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
Gene Code
 rpsD
Ortholog
 N0.HOG0001255 30S ribosomal protein S4
KEGG gene
 K02986 RP-S4, rpsD; small subunit ribosomal protein S4 kornec03010
Gene Ontology
 GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
 GO:1990904 ribonucleoprotein complex
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0080090 regulation of primary metabolic process
Gene Ontology
 GO:0065008 regulation of biological quality
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
 GO:0051247 positive regulation of protein metabolic process
Gene Ontology
 GO:0051246 regulation of protein metabolic process
Gene Ontology
 GO:0051173 positive regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0045903 positive regulation of translational fidelity
Gene Ontology
 GO:0045727 positive regulation of translation
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044446 obsolete intracellular organelle part
Gene Ontology
 GO:0044444 obsolete cytoplasmic part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044422 obsolete organelle part
Gene Ontology
 GO:0044391 ribosomal subunit
Gene Ontology
 GO:0043232 intracellular non-membrane-bounded organelle
Gene Ontology
 GO:0043229 intracellular organelle
Gene Ontology
 GO:0043228 non-membrane-bounded organelle
Gene Ontology
 GO:0043226 organelle
Gene Ontology
 GO:0034250 positive regulation of cellular amide metabolic process
Gene Ontology
 GO:0034248 regulation of cellular amide metabolic process
Gene Ontology
 GO:0032991 protein-containing complex
Gene Ontology
 GO:0032270 -
Gene Ontology
 GO:0032268 regulation of cellular protein metabolic process
Gene Ontology
 GO:0031328 positive regulation of cellular biosynthetic process
Gene Ontology
 GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
 GO:0031325 positive regulation of cellular metabolic process
Gene Ontology
 GO:0031323 regulation of cellular metabolic process
Gene Ontology
 GO:0019843 rRNA binding
Gene Ontology
 GO:0019222 regulation of metabolic process
Gene Ontology
 GO:0015935 small ribosomal subunit
Gene Ontology
 GO:0010628 positive regulation of gene expression
Gene Ontology
 GO:0010608 post-transcriptional regulation of gene expression
Gene Ontology
 GO:0010604 positive regulation of macromolecule metabolic process
Gene Ontology
 GO:0010557 positive regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
 GO:0010468 regulation of gene expression
Gene Ontology
 GO:0009893 positive regulation of metabolic process
Gene Ontology
 GO:0009891 positive regulation of biosynthetic process
Gene Ontology
 GO:0009889 regulation of biosynthetic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006450 regulation of translational fidelity
Gene Ontology
 GO:0006417 regulation of translation
Gene Ontology
 GO:0005840 ribosome
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0005198 structural molecule activity
Gene Ontology
 GO:0003735 structural constituent of ribosome
Gene Ontology
 GO:0003723 RNA binding
Gene Ontology
 GO:0003676 nucleic acid binding
Gene Ontology
 GO:0003674 molecular_function
Eggnog Protein
 EP:rpsD
Eggnog Ortholog
 EO:COG0522
Eggnog Description
 ED:One of the primary rRNA binding proteins
Gene Product
 30S ribosomal protein S4

Occurs in the following pathway maps:

Pathway Description
kornec03010 Ribosome

Sequences

Nucleotide sequence (GC-content: 52.5 %):

ATGTCACGTTACACTGGCCCAAGCTGGCGTCTTTCCCGGCGCCTGGGCGTTTCACTTTCTGGTACTGGTAAGGAACTTGCTCGTCGTCCGTACGCTCCTGGTGACCACGGGAACGACCGTCGCGGTAAGCTTTCCGAATACGGGACCCAACTTCGCGAAAAGCAAAAGCTTCGTTTCATGTACGGGATGACCGAACGGCAATTCTCTAACCTGTTCGTTCGCGCCGGCAAGATCAAGGAAGGTACTCACGGTACCAACTTCATGGTTCTGCTTGAACGTCGTCTGGACAACATGGTTTACCGTCTTGGTTTAGCTACCACGCGTCGTCAAGCACGCCAACTGGTTAACCACGGTCACATCACTGTTGACGGCAAGCGCGTTGACATTCCTTCCTACGAAGTTAAGGTTGGTCAAGTCATCGCCGTTCGTGAAAAGTCCAAGAACCTGGACGTTATCAAGGGTGCTGTTGAAGCCGTTGTTGCTCGCCCGGCTTACGTTGAATTCGACACTGATAAGCTCGAAGGTAAGCTGACCCGTCTTCCGCAACGTGAAGACATGAACGCCGACATCGACGAAGCCCTGATCGTTGAATTCTACAACAAGTAA

Protein sequence:

MSRYTGPSWRLSRRLGVSLSGTGKELARRPYAPGDHGNDRRGKLSEYGTQLREKQKLRFMYGMTERQFSNLFVRAGKIKEGTHGTNFMVLLERRLDNMVYRLGLATTRRQARQLVNHGHITVDGKRVDIPSYEVKVGQVIAVREKSKNLDVIKGAVEAVVARPAYVEFDTDKLEGKLTRLPQREDMNADIDEALIVEFYNK

GenBank Info

gene - rpsD
locus_tag - FAM19471-i1-1.1_000680
inference - COORDINATES: similar to AA sequence:RefSeq:WP_012390516.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - 30S ribosomal protein S4
protein_id - extdb:FAM19471-i1-1.1_000680

Gene Locus

Located on scaffold FAM19471-i1-1_scf9

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
FAM19471-i1-1.1_000679
FAM19471-i1-1.1_000681