update range to 10000 bp
locus tag: FAM19471-i1-1.1_000840 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
Gene Product
 ribosome recycling factor
Ortholog
 N0.HOG0001393 ribosome recycling factor
KEGG gene
 K02838 frr, MRRF, RRF; ribosome recycling factor
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:0071840 cellular component organization or biogenesis
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0044877 protein-containing complex binding
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044271 cellular nitrogen compound biosynthetic process
Gene Ontology
 GO:0044267 -
Gene Ontology
 GO:0044260 cellular macromolecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043933 protein-containing complex organization
Gene Ontology
 GO:0043624 -
Gene Ontology
 GO:0043604 amide biosynthetic process
Gene Ontology
 GO:0043603 cellular amide metabolic process
Gene Ontology
 GO:0043170 macromolecule metabolic process
Gene Ontology
 GO:0043043 peptide biosynthetic process
Gene Ontology
 GO:0043023 ribosomal large subunit binding
Gene Ontology
 GO:0043021 ribonucleoprotein complex binding
Gene Ontology
 GO:0034645 cellular macromolecule biosynthetic process
Gene Ontology
 GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
 GO:0032984 protein-containing complex disassembly
Gene Ontology
 GO:0022411 cellular component disassembly
Gene Ontology
 GO:0019538 protein metabolic process
Gene Ontology
 GO:0016043 cellular component organization
Gene Ontology
 GO:0010467 gene expression
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009059 macromolecule biosynthetic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006518 peptide metabolic process
Gene Ontology
 GO:0006415 translational termination
Gene Ontology
 GO:0006412 translation
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0002184 cytoplasmic translational termination
Gene Ontology
 GO:0002181 cytoplasmic translation
Gene Code
 frr
Eggnog Protein
 EP:frr
Eggnog Ortholog
 EO:COG0233
Eggnog Description
 ED:Responsible for the release of ribosomes from messenger RNA at the termination of protein biosynthesis. May increase the efficiency of translation by recycling ribosomes from one round of translation to another

Sequences

Nucleotide sequence (GC-content: 54.5 %):

ATGACTGGAAAAGAAATCCTCGCAGAAGCAAAGGAAAAGATGGCCAAGTCCGGTGATGCCTTGAAGCGGACCTTAGCCGACATTCGGGCCGGCCGGGCCAACGCGAGCCTCTTAAACACGGTAACGGTTGAATACTACGGCGCCCCGACGCCGCTTAACCAACTGGCATCGATCACGATCCCAGAAGCCCGCCAACTGTTGATCTCGCCGTACGACAAGACGACCTTAAAGGACATCGAACGGGCCATTTACGAATCCAACCTCGGCTTGACGCCGCAAAACGACGGGGAAACGATTCGGCTGGTGGTTCCGCAACTGACCGAAGACCGTCGTAAGGAACTGGTTAAAGACGTGAAGGCGGAAATGGAAAAGGCCAAGGTGGCCGTTCGTAACGTTCGTCGGGAAGCGATGGACGACCTCAAGAAGGGGAACAAGGACGGCGACTTCAACGACGACGAATTCCACGACCTGGAAAAGAAGGTCCAAGAAGAAACCGACGCCGGTATCAAGAACCTGGAACAAATCGCCGCTGACAAGGAAAAGGAACTGTTGGAAGGCTAA

Protein sequence:

MTGKEILAEAKEKMAKSGDALKRTLADIRAGRANASLLNTVTVEYYGAPTPLNQLASITIPEARQLLISPYDKTTLKDIERAIYESNLGLTPQNDGETIRLVVPQLTEDRRKELVKDVKAEMEKAKVAVRNVRREAMDDLKKGNKDGDFNDDEFHDLEKKVQEETDAGIKNLEQIAADKEKELLEG

GenBank Info

gene - frr
locus_tag - FAM19471-i1-1.1_000840
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003685219.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - ribosome recycling factor
protein_id - extdb:FAM19471-i1-1.1_000840

Gene Locus

Located on scaffold FAM19471-i1-1_scf12

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
FAM19471-i1-1.1_000839
FAM19471-i1-1.1_000841