update range to 10000 bp
locus tag: FAM19471-i1-1.1_001070 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
KEGG reaction
 R10305 O3-acetyl-L-serine:L-homocysteine S-(2-amino-2-carboxyethyl)transferase; O-Acetyl-L-serine + L-Homocysteine <=> L-Cystathionine + Acetate kornec00270kornec01100kornec01230
KEGG reaction
 R04859 O3-acetyl-L-serine:thiosulfate 2-amino-2-carboxyethyltransferase (reducing, L-cysteine-forming); O3-acetyl-L-serine acetate-lyase (thiosulfate-reducing, L-cysteine-forming); O-Acetyl-L-serine + Thiosulfate + Thioredoxin + H+ <=> L-Cysteine + Sulfite + Thioredoxin disulfide + Acetate
KEGG reaction
 R03601 O3-Acetyl-L-serine acetate-lyase (adding hydrogen sulfide); O-Acetyl-L-serine + Hydrogen selenide <=> L-Selenocysteine + Acetate
KEGG reaction
 R00897 O3-acetyl-L-serine:hydrogen-sulfide 2-amino-2-carboxyethyltransferase; O3-acetyl-L-serine acetate-lyase (adding hydrogen sulfide); O-Acetyl-L-serine + Hydrogen sulfide <=> L-Cysteine + Acetate kornec00270kornec00920kornec01100kornec01110kornec01120kornec01200kornec01230
Gene Product
 PLP-dependent cysteine synthase family protein
Ortholog
 N0.HOG0000441 cysteine synthase family protein
KEGG gene
 K17216 mccA; cystathionine beta-synthase (O-acetyl-L-serine) [EC:2.5.1.134] kornec00270kornec01100kornec01230
KEGG gene
 K01738 cysK; cysteine synthase [EC:2.5.1.47] kornec00270kornec00920kornec01100kornec01110kornec01120kornec01200kornec01230
Gene Ontology
 GO:1901607 alpha-amino acid biosynthetic process
Gene Ontology
 GO:1901605 alpha-amino acid metabolic process
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:1901363 heterocyclic compound binding
Gene Ontology
 GO:0097159 organic cyclic compound binding
Gene Ontology
 GO:0080146 L-cysteine desulfhydrase activity
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0070279 vitamin B6 binding
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0050794 regulation of cellular process
Gene Ontology
 GO:0050789 regulation of biological process
Gene Ontology
 GO:0050662 obsolete coenzyme binding
Gene Ontology
 GO:0048522 positive regulation of cellular process
Gene Ontology
 GO:0048518 positive regulation of biological process
Gene Ontology
 GO:0048037 obsolete cofactor binding
Gene Ontology
 GO:0046394 carboxylic acid biosynthetic process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044272 sulfur compound biosynthetic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043436 oxoacid metabolic process
Gene Ontology
 GO:0043168 anion binding
Gene Ontology
 GO:0043167 ion binding
Gene Ontology
 GO:0042127 regulation of cell population proliferation
Gene Ontology
 GO:0036094 small molecule binding
Gene Ontology
 GO:0030170 pyridoxal phosphate binding
Gene Ontology
 GO:0019842 vitamin binding
Gene Ontology
 GO:0019752 carboxylic acid metabolic process
Gene Ontology
 GO:0019344 cysteine biosynthetic process
Gene Ontology
 GO:0016846 carbon-sulfur lyase activity
Gene Ontology
 GO:0016836 hydro-lyase activity
Gene Ontology
 GO:0016835 carbon-oxygen lyase activity
Gene Ontology
 GO:0016829 lyase activity
Gene Ontology
 GO:0016765 transferase activity, transferring alkyl or aryl (other than methyl) groups
Gene Ontology
 GO:0016740 transferase activity
Gene Ontology
 GO:0016053 organic acid biosynthetic process
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009070 serine family amino acid biosynthetic process
Gene Ontology
 GO:0009069 serine family amino acid metabolic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008652 cellular amino acid biosynthetic process
Gene Ontology
 GO:0008284 positive regulation of cell population proliferation
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0008144 obsolete drug binding
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006790 sulfur compound metabolic process
Gene Ontology
 GO:0006563 L-serine metabolic process
Gene Ontology
 GO:0006535 cysteine biosynthetic process from serine
Gene Ontology
 GO:0006534 cysteine metabolic process
Gene Ontology
 GO:0006520 cellular amino acid metabolic process
Gene Ontology
 GO:0006082 organic acid metabolic process
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0005488 binding
Gene Ontology
 GO:0004124 cysteine synthase activity
Gene Ontology
 GO:0004122 cystathionine beta-synthase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0000097 sulfur amino acid biosynthetic process
Gene Ontology
 GO:0000096 sulfur amino acid metabolic process
Eggnog Protein
 EP:mccA
Eggnog Ortholog
 EO:COG0031
Eggnog Description
 ED:Belongs to the cysteine synthase cystathionine beta- synthase family
EC Number
 EC:2.5.1.47 cysteine synthase; O-acetyl-L-serine sulfhydrylase; O-acetyl-L-serine sulfohydrolase; O-acetylserine (thiol)-lyase; O-acetylserine (thiol)-lyase A; O-acetylserine sulfhydrylase; O3-acetyl-L-serine acetate-lyase (adding hydrogen-sulfide); acetylserine sulfhydrylase; cysteine synthetase; S-sulfocysteine synthase; 3-O-acetyl-L-serine:hydrogen-sulfide 2-amino-2-carboxyethyltransferase; O3-acetyl-L-serine:hydrogen-sulfide 2-amino-2-carboxyethyltransferase kornec00270kornec00920kornec01100kornec01110kornec01120
EC Number
 EC:2.5.1.134 cystathionine beta-synthase (O-acetyl-L-serine); MccB; O-acetylserine dependent cystathionine beta-synthase kornec00270kornec01100

Occurs in the following pathway maps:

Pathway Description
kornec00270 Cysteine and methionine metabolism
kornec00920 Sulfur metabolism
kornec01100 Metabolic pathways
kornec01110 Biosynthesis of secondary metabolites
kornec01120 Microbial metabolism in diverse environments
kornec01200 Carbon metabolism
kornec01230 Biosynthesis of amino acids

Sequences

Nucleotide sequence (GC-content: 57.3 %):

ATGCTAGTTCACAATGTTTACCAATTAATCGGCCACACCCCGCTCTTGGAGTTGCCGCTTGACGTCCCCAACGGCAGTCACGTCTTTGCCAAGTTAGAAATGTATAACCCGGGGGGCTCGATCAAAGACCGCCTGGGGATGGCCCTGATTGAAGACGGGATTTCCCGCGGGGCGATCACGAACACGACCACGATCATTGAACCGACCGCCGGTAACACCGGGATCGGGGTCGCCCTGGCTGCCGCTAAGCACCGCCTCAAGACAATTCTGGTGGTTCCGGAGCACTTTAGCTTTGAAAAGCAGACACTGATGAAGGCGCTCGGCGCGGAGGTAATTAACACGCCGGACGAGGGCGGAATGACCGGGGCCACCGCAAAGGCCTTGGAGCTGGCCGCCAGCATTGCCGATTCCTACGTGCCTAACCAGTTCGCTAACTTCGATAACCCACGGGCCTACGAACGGACGCTGGGCCCGGAAATTATCAGTGACTTAAACGGGCAACCAATCGACGCCTTTGTGGCCGGGGCCGGCACCGGGGGCACCTTTGCCGGAACCGCTAAGGCGCTCTTAAACGTCTACCCGAACGCTTACACGGTTGCGGTTCAGCCCAAGGGATCCATTCTCGATCACCAACCCAAGGGCGACCACCGTACCGAGGGGATTGGGGTTGAACAGGTGCCACCCTTCTTTAGCGGTTTAAAGATCGACGAGGTCCAAACGATTACCGATGACGATGCCTTTGGCTGGGTTAAACGGGCGGCTAGGGAGCTGGGGCTTTTGATCGGCTCTTCCTCTGGTTCGGCCCTGGCCGCCAGTTTGAAGGTCGCCGAAAAACTACCCGCCGGCGCCAATATCGTCACCATTTTCCCCGACTCTAGCGAACGTTACTTAAGCGAAAACATTTACGAATAA

Protein sequence:

MLVHNVYQLIGHTPLLELPLDVPNGSHVFAKLEMYNPGGSIKDRLGMALIEDGISRGAITNTTTIIEPTAGNTGIGVALAAAKHRLKTILVVPEHFSFEKQTLMKALGAEVINTPDEGGMTGATAKALELAASIADSYVPNQFANFDNPRAYERTLGPEIISDLNGQPIDAFVAGAGTGGTFAGTAKALLNVYPNAYTVAVQPKGSILDHQPKGDHRTEGIGVEQVPPFFSGLKIDEVQTITDDDAFGWVKRAARELGLLIGSSSGSALAASLKVAEKLPAGANIVTIFPDSSERYLSENIYE

GenBank Info

locus_tag - FAM19471-i1-1.1_001070
inference - COORDINATES: similar to AA sequence:RefSeq:WP_012391259.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - PLP-dependent cysteine synthase family protein
protein_id - extdb:FAM19471-i1-1.1_001070

Gene Locus

Located on scaffold FAM19471-i1-1_scf18

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
FAM19471-i1-1.1_001069
FAM19471-i1-1.1_001071