Annotations

Type Name Description Pathways
Ortholog
N0.HOG0000502 ATP-dependent Clp protease proteolytic subunit
KEGG gene
K01358 clpP, CLPP; ATP-dependent Clp protease, protease subunit [EC:3.4.21.92] kornec04112kornec04212
Gene Ontology
GO:2001141 regulation of RNA biosynthetic process
Gene Ontology
GO:2000113 negative regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:1903507 negative regulation of nucleic acid-templated transcription
Gene Ontology
GO:1903506 regulation of nucleic acid-templated transcription
Gene Ontology
GO:1902679 negative regulation of RNA biosynthetic process
Gene Ontology
GO:1901575 organic substance catabolic process
Gene Ontology
GO:1901565 organonitrogen compound catabolic process
Gene Ontology
GO:1901564 organonitrogen compound metabolic process
Gene Ontology
GO:0140096 catalytic activity, acting on a protein
Gene Ontology
GO:0080090 regulation of primary metabolic process
Gene Ontology
GO:0071704 organic substance metabolic process
Gene Ontology
GO:0070011 -
Gene Ontology
GO:0065007 biological regulation
Gene Ontology
GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
GO:0051603 proteolysis involved in protein catabolic process
Gene Ontology
GO:0051253 negative regulation of RNA metabolic process
Gene Ontology
GO:0051252 regulation of RNA metabolic process
Gene Ontology
GO:0051172 negative regulation of nitrogen compound metabolic process
Gene Ontology
GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
GO:0050794 regulation of cellular process
Gene Ontology
GO:0050789 regulation of biological process
Gene Ontology
GO:0048523 negative regulation of cellular process
Gene Ontology
GO:0048519 negative regulation of biological process
Gene Ontology
GO:0045934 negative regulation of nucleobase-containing compound metabolic process
Gene Ontology
GO:0045892 negative regulation of DNA-templated transcription
Gene Ontology
GO:0044267 -
Gene Ontology
GO:0044265 cellular macromolecule catabolic process
Gene Ontology
GO:0044260 cellular macromolecule metabolic process
Gene Ontology
GO:0044257 -
Gene Ontology
GO:0044248 cellular catabolic process
Gene Ontology
GO:0044238 primary metabolic process
Gene Ontology
GO:0044237 cellular metabolic process
Gene Ontology
GO:0043170 macromolecule metabolic process
Gene Ontology
GO:0042802 identical protein binding
Gene Ontology
GO:0042623 -
Gene Ontology
GO:0031327 negative regulation of cellular biosynthetic process
Gene Ontology
GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
GO:0031324 negative regulation of cellular metabolic process
Gene Ontology
GO:0031323 regulation of cellular metabolic process
Gene Ontology
GO:0030163 protein catabolic process
Gene Ontology
GO:0019538 protein metabolic process
Gene Ontology
GO:0019222 regulation of metabolic process
Gene Ontology
GO:0019219 regulation of nucleobase-containing compound metabolic process
Gene Ontology
GO:0017111 ribonucleoside triphosphate phosphatase activity
Gene Ontology
GO:0016887 ATP hydrolysis activity
Gene Ontology
GO:0016818 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
Gene Ontology
GO:0016817 hydrolase activity, acting on acid anhydrides
Gene Ontology
GO:0016787 hydrolase activity
Gene Ontology
GO:0016462 pyrophosphatase activity
Gene Ontology
GO:0010629 negative regulation of gene expression
Gene Ontology
GO:0010605 negative regulation of macromolecule metabolic process
Gene Ontology
GO:0010558 negative regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010468 regulation of gene expression
Gene Ontology
GO:0009987 cellular process
Gene Ontology
GO:0009892 negative regulation of metabolic process
Gene Ontology
GO:0009890 negative regulation of biosynthetic process
Gene Ontology
GO:0009889 regulation of biosynthetic process
Gene Ontology
GO:0009057 macromolecule catabolic process
Gene Ontology
GO:0009056 catabolic process
Gene Ontology
GO:0008233 peptidase activity
Gene Ontology
GO:0008152 metabolic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0006807 nitrogen compound metabolic process
Gene Ontology
GO:0006515 protein quality control for misfolded or incompletely synthesized proteins
Gene Ontology
GO:0006508 proteolysis
Gene Ontology
GO:0006355 regulation of DNA-templated transcription
Gene Ontology
GO:0005515 protein binding
Gene Ontology
GO:0005488 binding
Gene Ontology
GO:0004176 ATP-dependent peptidase activity
Gene Ontology
GO:0003824 catalytic activity
Gene Ontology
GO:0003674 molecular_function
Eggnog Protein
EP:clpP
Eggnog Ortholog
EO:COG0740
Eggnog Description
ED:Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins
EC Number
EC:3.4.21.92 endopeptidase Clp; endopeptidase Ti; caseinolytic protease; protease Ti; ATP-dependent Clp protease; ClpP; Clp protease
Gene Code
clpP
Gene Product
ATP-dependent Clp endopeptidase proteolytic subunit ClpP

Occurs in the following pathway maps:

Pathway Description
kornec04112 Cell cycle - Caulobacter
kornec04212 Longevity regulating pathway - worm

Sequences

Nucleotide sequence (GC-content: 48.9 %):

ATGAACTTAGTACCAACCGTCATTGAGCAATCGTCCCGTGGCGAACGCGCTTATGACATTTACTCCCGTCTTTTAAAGGACCGGATCATCATGTTATCTGGTCCGATTGAAGACAACATGGCAAACTCAATTGTTGCCCAACTGCTCTTCTTGGACGCCCAAGATTCCACCAAGGACATCTACTTATACATCAACTCCCCTGGTGGGGTGGTTACCTCTGGGATGGCAATCTACGACACGATGAACTTCATCAAGTCTGACGTTCAAACGATCGTGATCGGAATGGCTGCTTCAATGGCATCCGTCCTGGTTTCCTCCGGGACCAAGGGGAAGCGGTTCGGTCTTCCACACTCAACCGTGATGATTCACCAACCATCCGGTGGTGCCCAAGGTCAACAAACCGAAATCCAAATTGCCGCCGAAGAAATCCTGAAGACCCGCAAGATGATCAACGAAATTCTTGCTAAGAACTCCGGGCAAAGCTTCGAGCAAGTTGAACAAGATACTGAACGGGATCACTACTTAACCGCCCAAGAAGCCGTGGATTACGGCCTGTTGGATGGGGTTATGGATTCAAACAATCTGAAGTAA

Protein sequence:

MNLVPTVIEQSSRGERAYDIYSRLLKDRIIMLSGPIEDNMANSIVAQLLFLDAQDSTKDIYLYINSPGGVVTSGMAIYDTMNFIKSDVQTIVIGMAASMASVLVSSGTKGKRFGLPHSTVMIHQPSGGAQGQQTEIQIAAEEILKTRKMINEILAKNSGQSFEQVEQDTERDHYLTAQEAVDYGLLDGVMDSNNLK

GenBank Info

gene - clpP
locus_tag - FAM19471-i1-1.1_001547
EC_number - 3.4.21.92
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003717598.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - ATP-dependent Clp endopeptidase proteolytic subunit ClpP
protein_id - extdb:FAM19471-i1-1.1_001547

Gene Locus

Located on scaffold FAM19471-i1-1_scf35


FAM19471-i1-1.1_001546
FAM19471-i1-1.1_001548