FAM13496-i1-1.1_001381 - OpenGenomeBrowser

Annotations

Type	Name	Description
Gene Product	segregation/condensation protein B
Ortholog	N0.HOG0001452	SMC-Scp complex subunit ScpB
KEGG gene	K06024	scpB; segregation and condensation protein B
Gene Ontology	GO:0042802	identical protein binding
Gene Ontology	GO:0005515	protein binding
Gene Ontology	GO:0005488	binding
Gene Ontology	GO:0003674	molecular_function
Eggnog Protein	EP:scpB
Eggnog Ortholog	EO:COG1386
Eggnog Description	ED:Participates in chromosomal partition during cell division. May act via the formation of a condensin-like complex containing Smc and ScpA that pull DNA away from mid-cell into both cell halves

Sequences

Nucleotide sequence (GC-content: 42.6 %):

ATGAGTAGTCACTTAGCACGATTAGAAGCCCTACTTTTTGTAGCTGGTGAAGATGGTCTTAGTCTAAGGACTATGGCACAGCTCTTGGAAATACCAGTGACGGGACTGACTCAGTCCTTAGAAAAATTGCAAGCCAAGTATGAGGCAGATGAGGACACAGCACTTTGTTTATTGGAATCGTCAAATACCTATAAGATCGTGACTAAGCCTGATTTTGCATGTCTTCTGCGTGACTATTCTAAAACGCCAATCAACCAAAGTCTATCCCGAGCGAGTCTCGAGGTACTTTCTATAGTTGCTTATAAACAGCCCATTACTCGCGCTGAAGTTGATGATATTCGAGGTGTCAATTCCAGTGGTGCTATTGCCAAGCTTCAGGCTTTTGGTCTCATTCGAGAGGCTGGTAAAAAGGATGCTGTGGGTCGTCCCAACCTATATGCGACAACTGATTATTTCTTGGATTATATAGGAATTAACAGTTTAGACGAACTTGTGGCCATTGATCAACTAGAACTTGAAGAGCAAGAAACGAGCCTATTTAGGGAGGATGCTCCAGAAGATCTTGAGGATTTGGACAATTAA

Protein sequence:

MSSHLARLEALLFVAGEDGLSLRTMAQLLEIPVTGLTQSLEKLQAKYEADEDTALCLLESSNTYKIVTKPDFACLLRDYSKTPINQSLSRASLEVLSIVAYKQPITRAEVDDIRGVNSSGAIAKLQAFGLIREAGKKDAVGRPNLYATTDYFLDYIGINSLDELVAIDQLELEEQETSLFREDAPEDLEDLDN

GenBank Info

locus_tag - FAM13496-i1-1.1_001381
inference - COORDINATES: similar to AA sequence:RefSeq:WP_013990032.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - segregation/condensation protein B
protein_id - extdb:FAM13496-i1-1.1_001381

Annotations

Sequences

GenBank Info

Gene Locus