Annotations

Type Name Description Pathways
Gene Code
tuf
Ortholog
N0.HOG0001369 elongation factor Tu
KEGG gene
K15771 ganP, mdxF; arabinogalactan oligomer / maltooligosaccharide transport system permease protein kornec02010
KEGG gene
K02358 tuf, TUFM; elongation factor Tu kornec04626
Gene Ontology
GO:2000484 -
Gene Ontology
GO:2000482 -
Gene Ontology
GO:1904951 positive regulation of establishment of protein localization
Gene Ontology
GO:1903532 positive regulation of secretion by cell
Gene Ontology
GO:1903530 regulation of secretion by cell
Gene Ontology
GO:0090087 regulation of peptide transport
Gene Ontology
GO:0071944 cell periphery
Gene Ontology
GO:0070201 regulation of establishment of protein localization
Gene Ontology
GO:0065007 biological regulation
Gene Ontology
GO:0051817 obsolete modulation of process of other organism involved in symbiotic interaction
Gene Ontology
GO:0051704 obsolete multi-organism process
Gene Ontology
GO:0051701 biological process involved in interaction with host
Gene Ontology
GO:0051240 positive regulation of multicellular organismal process
Gene Ontology
GO:0051239 regulation of multicellular organismal process
Gene Ontology
GO:0051223 regulation of protein transport
Gene Ontology
GO:0051222 positive regulation of protein transport
Gene Ontology
GO:0051050 positive regulation of transport
Gene Ontology
GO:0051049 regulation of transport
Gene Ontology
GO:0051047 positive regulation of secretion
Gene Ontology
GO:0051046 regulation of secretion
Gene Ontology
GO:0050794 regulation of cellular process
Gene Ontology
GO:0050789 regulation of biological process
Gene Ontology
GO:0050715 -
Gene Ontology
GO:0050714 positive regulation of protein secretion
Gene Ontology
GO:0050708 regulation of protein secretion
Gene Ontology
GO:0050707 -
Gene Ontology
GO:0048522 positive regulation of cellular process
Gene Ontology
GO:0048518 positive regulation of biological process
Gene Ontology
GO:0044651 adhesion of symbiont to host epithelial cell
Gene Ontology
GO:0044650 adhesion of symbiont to host cell
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044462 obsolete external encapsulating structure part
Gene Ontology
GO:0044426 obsolete cell wall part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044419 biological process involved in interspecies interaction between organisms
Gene Ontology
GO:0044406 adhesion of symbiont to host
Gene Ontology
GO:0044403 biological process involved in symbiotic interaction
Gene Ontology
GO:0044068 modulation by symbiont of host cellular process
Gene Ontology
GO:0044003 modulation by symbiont of host process
Gene Ontology
GO:0035821 modulation of process of another organism
Gene Ontology
GO:0032880 regulation of protein localization
Gene Ontology
GO:0032879 regulation of localization
Gene Ontology
GO:0032757 positive regulation of interleukin-8 production
Gene Ontology
GO:0032677 regulation of interleukin-8 production
Gene Ontology
GO:0030312 external encapsulating structure
Gene Ontology
GO:0022610 obsolete biological adhesion
Gene Ontology
GO:0016020 membrane
Gene Ontology
GO:0010339 external side of cell wall
Gene Ontology
GO:0009986 cell surface
Gene Ontology
GO:0009275 Gram-positive-bacterium-type cell wall
Gene Ontology
GO:0009274 peptidoglycan-based cell wall
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0005886 plasma membrane
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005618 cell wall
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0002793 positive regulation of peptide secretion
Gene Ontology
GO:0002791 regulation of peptide secretion
Gene Ontology
GO:0001819 positive regulation of cytokine production
Gene Ontology
GO:0001817 regulation of cytokine production
Eggnog Protein
EP:tuf
Eggnog Ortholog
EO:COG0050
Gene Product
elongation factor Tu
Eggnog Description
ED:This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis

Occurs in the following pathway maps:

Pathway Description
kornec02010 ABC transporters
kornec04626 Plant-pathogen interaction

Sequences

Nucleotide sequence (GC-content: 49.7 %):

ATGGCAGAAAAAGAACATTATGAACGTACTAAGCCCCACGTTAACATCGGTACTATTGGCCACGTTGACCACGGGAAGACTACTTTAACCGCAGCTATCACCAAGGTATTGGCCGCTAAGGGCCTTGCCAAGGCAGAAGACTACTCTGATATCGATGCTGCTCCAGAAGAAAAGGAACGTGGTATCACTATCAACACTGCCCACGTTGAATACGAAACGGAAAAGCGTCACTACGCTCACATCGACGCTCCAGGGCACGCCGACTACGTTAAGAACATGATCACTGGGGCCGCTCAAATGGACGGTGCGATCTTAGTTGTTGCCGCAACTGATGGTCCGATGCCACAAACTCGTGAACACATCCTTCTGGCTCGCCAGGTCGGTGTTGAATACATCGTTGTCTTCCTTAACAAGACTGACCTTGTTGACGATGACGAACTGGTTGACTTAGTTGAAATGGAAGTTCGTGACCTTCTGTCCGAATACGACTTCCCTGGCGATGATGTTCCGGTTGTTCGTGGGTCCGCTCTTAAGGCCCTCGAAGGTGACCCAGAACAAGAACAAGTTGTTCTTCACCTTCTGGACGTCGTTGACGAATACATCCCAACTCCAAAGCGTCCTACTGACAAGCCATTCATGATGCCTGTCGAAGACGTCTTCACTATCACTGGTCGTGGTACTGTTGCTTCTGGTCGTATCGACCGTGGTACTGTTAAGATCGGTGACGAAGTTGAAATCGTTGGTTTGAAGGAAGACGTTATCAAGTCCACTGTTACCGGTGTTGAAATGTTCCACAAGACCCTTGATCTTGGGGAAGCCGGGGACAACGTCGGTGTCCTTTTACGTGGGGTTTCTCACGACCAAATCGAACGTGGTCAAGTTCTGGCAGAACCAGGCTCCATCCAAACGCACAAGCAATTCAAGGGTGAAGTCTACGTTATGACCAAGGAAGAAGGGGGCCGTCACACGCCATTCTTCTCCAACTACCGCCCACAATTCTACTTCCACACTACTGACGTTACTGGTACCATTGAACTCCCAGATGGTGTTGAAATGGTTATGCCTGGTGACAACGTTACCTTCACTGTTGAACTGCAAAAGCCAGTTGCCCTTGAAAAGGGTCTGAAGTTCACCATCCGTGAAGGTGGTCACACTGTTGGTGCCGGTGTGGTATCCGAAGTGCTCGACTAA

Protein sequence:

MAEKEHYERTKPHVNIGTIGHVDHGKTTLTAAITKVLAAKGLAKAEDYSDIDAAPEEKERGITINTAHVEYETEKRHYAHIDAPGHADYVKNMITGAAQMDGAILVVAATDGPMPQTREHILLARQVGVEYIVVFLNKTDLVDDDELVDLVEMEVRDLLSEYDFPGDDVPVVRGSALKALEGDPEQEQVVLHLLDVVDEYIPTPKRPTDKPFMMPVEDVFTITGRGTVASGRIDRGTVKIGDEVEIVGLKEDVIKSTVTGVEMFHKTLDLGEAGDNVGVLLRGVSHDQIERGQVLAEPGSIQTHKQFKGEVYVMTKEEGGRHTPFFSNYRPQFYFHTTDVTGTIELPDGVEMVMPGDNVTFTVELQKPVALEKGLKFTIREGGHTVGAGVVSEVLD

GenBank Info

gene - tuf
locus_tag - FAM19471-i1-1.1_000614
inference - COORDINATES: similar to AA sequence:RefSeq:WP_012391019.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - elongation factor Tu
protein_id - extdb:FAM19471-i1-1.1_000614

Gene Locus

Located on scaffold FAM19471-i1-1_scf8


Cellular location expand

Responsible annotations:
SL-0041: GO:0005618 cell wall
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0039: GO:0005886 plasma membrane
SL-0310: GO:0009986 cell surface
SL-0162: GO:0016020 membrane

FAM19471-i1-1.1_000613
FAM19471-i1-1.1_000615