Annotations

Type Name Description Pathways
KEGG reaction
R04378 1-(5'-Phosphoribosyl)-5-amino-4-imidazolecarboxamide:pyrophosphate phosphoribosyltransferase; 1-(5'-Phosphoribosyl)-5-amino-4-imidazolecarboxamide + Diphosphate <=> 5-Amino-4-imidazolecarboxyamide + 5-Phospho-alpha-D-ribose 1-diphosphate kornec00230kornec01100
KEGG reaction
R01229 GMP:diphosphate 5-phospho-alpha-D-ribosyltransferase; GMP + Diphosphate <=> Guanine + 5-Phospho-alpha-D-ribose 1-diphosphate kornec00230kornec01100
KEGG reaction
R00190 AMP:diphosphate phospho-D-ribosyltransferase; AMP + Diphosphate <=> Adenine + 5-Phospho-alpha-D-ribose 1-diphosphate kornec00230kornec01100
Ortholog
N0.HOG0001373 adenine phosphoribosyltransferase
KEGG gene
K00759 APRT, apt; adenine phosphoribosyltransferase [EC:2.4.2.7] kornec00230kornec01100
Gene Ontology
GO:1901576 organic substance biosynthetic process
Gene Ontology
GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
GO:1901564 organonitrogen compound metabolic process
Gene Ontology
GO:1901362 organic cyclic compound biosynthetic process
Gene Ontology
GO:1901360 organic cyclic compound metabolic process
Gene Ontology
GO:0072522 purine-containing compound biosynthetic process
Gene Ontology
GO:0072521 purine-containing compound metabolic process
Gene Ontology
GO:0071704 organic substance metabolic process
Gene Ontology
GO:0055086 nucleobase-containing small molecule metabolic process
Gene Ontology
GO:0046483 heterocycle metabolic process
Gene Ontology
GO:0046148 pigment biosynthetic process
Gene Ontology
GO:0046112 nucleobase biosynthetic process
Gene Ontology
GO:0046084 adenine biosynthetic process
Gene Ontology
GO:0046083 adenine metabolic process
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044281 small molecule metabolic process
Gene Ontology
GO:0044271 cellular nitrogen compound biosynthetic process
Gene Ontology
GO:0044249 cellular biosynthetic process
Gene Ontology
GO:0044238 primary metabolic process
Gene Ontology
GO:0044237 cellular metabolic process
Gene Ontology
GO:0043101 purine-containing compound salvage
Gene Ontology
GO:0043096 purine nucleobase salvage
Gene Ontology
GO:0043094 cellular metabolic compound salvage
Gene Ontology
GO:0042440 pigment metabolic process
Gene Ontology
GO:0034654 nucleobase-containing compound biosynthetic process
Gene Ontology
GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
GO:0019438 aromatic compound biosynthetic process
Gene Ontology
GO:0018130 heterocycle biosynthetic process
Gene Ontology
GO:0016763 pentosyltransferase activity
Gene Ontology
GO:0016757 glycosyltransferase activity
Gene Ontology
GO:0016740 transferase activity
Gene Ontology
GO:0009987 cellular process
Gene Ontology
GO:0009113 purine nucleobase biosynthetic process
Gene Ontology
GO:0009112 nucleobase metabolic process
Gene Ontology
GO:0009058 biosynthetic process
Gene Ontology
GO:0008152 metabolic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0006807 nitrogen compound metabolic process
Gene Ontology
GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
GO:0006168 adenine salvage
Gene Ontology
GO:0006144 purine nucleobase metabolic process
Gene Ontology
GO:0006139 nucleobase-containing compound metabolic process
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0003999 adenine phosphoribosyltransferase activity
Gene Ontology
GO:0003824 catalytic activity
Gene Ontology
GO:0003674 molecular_function
Eggnog Protein
EP:apt
Eggnog Ortholog
EO:COG0503
Eggnog Description
ED:Catalyzes a salvage reaction resulting in the formation of AMP
EC Number
EC:2.4.2.7 adenine phosphoribosyltransferase; AMP pyrophosphorylase; transphosphoribosidase; APRT; AMP-pyrophosphate phosphoribosyltransferase; adenine phosphoribosylpyrophosphate transferase; adenosine phosphoribosyltransferase; adenylate pyrophosphorylase; adenylic pyrophosphorylase kornec00230kornec01100
Gene Product
adenine phosphoribosyltransferase

Occurs in the following pathway maps:

Pathway Description
kornec00230 Purine metabolism
kornec01100 Metabolic pathways

Sequences

Nucleotide sequence (GC-content: 55.3 %):

ATGGCTATTAATCTTTACGATTACGTCGCTAGCATTTCGGATTACCCCGAAAAAGGGATCGTTTTCCGCGACATCTTGCCGCTGATGGCAAACGGGGAGGCCTTCAAGCAGGCCACCGATGAAATTGCCAACTACGCTCGCGACAAGCACGTTGACATGGTGGTCGGTCCAGAGGCCCGGGGCTTCATCGTTGGTTGCCCGGTTGCTTACGAACTCGGGGTCGGCTTTGCCCCGGCCCGTAAGAAGGGGAAACTGCCCCGGCCGGCAGTCTCTTCGACTTACGACCTGGAATACGGGTCGGCAACCCTGCAAATGGAAAATGATTCCATCAAGCCGGGCCAACGGGTGCTAGTCGTTGATGACCTCTTGGCTACCGGGGGCACGATTTCGGCCACCATCGACATGGTTGAACAAATGGGCGGGATCGTGGTCGGTTGTGCCTTCTTGATCGACTTAAAGGACCTAAACGGCCGCGAAAAGCTGAAGGGTTATGACGTTAAGACCCTGATGGAATTCGAGGGAGAATAG

Protein sequence:

MAINLYDYVASISDYPEKGIVFRDILPLMANGEAFKQATDEIANYARDKHVDMVVGPEARGFIVGCPVAYELGVGFAPARKKGKLPRPAVSSTYDLEYGSATLQMENDSIKPGQRVLVVDDLLATGGTISATIDMVEQMGGIVVGCAFLIDLKDLNGREKLKGYDVKTLMEFEGE

GenBank Info

locus_tag - FAM19471-i1-1.1_000626
EC_number - 2.4.2.7
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003682042.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - adenine phosphoribosyltransferase
protein_id - extdb:FAM19471-i1-1.1_000626

Gene Locus

Located on scaffold FAM19471-i1-1_scf8


Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm

FAM19471-i1-1.1_000625
FAM19471-i1-1.1_000627