update range to 10000 bp
locus tag: FAM19471-i1-1.1_000773 genome: FAM19471-i1-1.1
species: Limosilactobacillus fermentum taxid: 1613

Annotations

Type Name Description Pathways
KEGG reaction
 R10908 (S)-ureidoglycine:glyoxylate aminotransferase; (S)-Ureidoglycine + Glyoxylate <=> Glycine + Oxalureate kornec00230kornec01100
KEGG reaction
 R00588 L-Serine:glyoxylate aminotransferase; L-Serine + Glyoxylate <=> Hydroxypyruvate + Glycine kornec00260kornec00630kornec00680kornec01100kornec01110kornec01120kornec01200
KEGG reaction
 R00585 L-Serine:pyruvate aminotransferase; L-Serine + Pyruvate <=> Hydroxypyruvate + L-Alanine kornec00260kornec01100
KEGG reaction
 R00372 Glycine:2-oxoglutarate aminotransferase; Glycine + 2-Oxoglutarate <=> Glyoxylate + L-Glutamate kornec00260kornec00630kornec01100kornec01110kornec01200
KEGG reaction
 R00369 L-Alanine:glyoxylate aminotransferase; L-Alanine + Glyoxylate <=> Pyruvate + Glycine kornec00250kornec01100
Ortholog
 N0.HOG0003911 alanine--glyoxylate aminotransferase family protein
KEGG gene
 K00839 pucG; (S)-ureidoglycine---glyoxylate transaminase [EC:2.6.1.112] kornec00230kornec01100
KEGG gene
 K00830 AGXT; alanine-glyoxylate transaminase / serine-glyoxylate transaminase / serine-pyruvate transaminase [EC:2.6.1.44 2.6.1.45 2.6.1.51] kornec00250kornec00260kornec00630kornec00680kornec01100kornec01110kornec01120kornec01200kornec04146
Gene Ontology
 GO:1901607 alpha-amino acid biosynthetic process
Gene Ontology
 GO:1901605 alpha-amino acid metabolic process
Gene Ontology
 GO:1901576 organic substance biosynthetic process
Gene Ontology
 GO:1901566 organonitrogen compound biosynthetic process
Gene Ontology
 GO:1901564 organonitrogen compound metabolic process
Gene Ontology
 GO:0071704 organic substance metabolic process
Gene Ontology
 GO:0065008 regulation of biological quality
Gene Ontology
 GO:0065007 biological regulation
Gene Ontology
 GO:0046394 carboxylic acid biosynthetic process
Gene Ontology
 GO:0044464 obsolete cell part
Gene Ontology
 GO:0044444 obsolete cytoplasmic part
Gene Ontology
 GO:0044424 obsolete intracellular part
Gene Ontology
 GO:0044283 small molecule biosynthetic process
Gene Ontology
 GO:0044281 small molecule metabolic process
Gene Ontology
 GO:0044249 cellular biosynthetic process
Gene Ontology
 GO:0044238 primary metabolic process
Gene Ontology
 GO:0044237 cellular metabolic process
Gene Ontology
 GO:0043436 oxoacid metabolic process
Gene Ontology
 GO:0043231 intracellular membrane-bounded organelle
Gene Ontology
 GO:0043229 intracellular organelle
Gene Ontology
 GO:0043227 membrane-bounded organelle
Gene Ontology
 GO:0043226 organelle
Gene Ontology
 GO:0042579 microbody
Gene Ontology
 GO:0042136 neurotransmitter biosynthetic process
Gene Ontology
 GO:0042133 neurotransmitter metabolic process
Gene Ontology
 GO:0019752 carboxylic acid metabolic process
Gene Ontology
 GO:0019265 glycine biosynthetic process, by transamination of glyoxylate
Gene Ontology
 GO:0017144 -
Gene Ontology
 GO:0016769 transferase activity, transferring nitrogenous groups
Gene Ontology
 GO:0016740 transferase activity
Gene Ontology
 GO:0016053 organic acid biosynthetic process
Gene Ontology
 GO:0009987 cellular process
Gene Ontology
 GO:0009070 serine family amino acid biosynthetic process
Gene Ontology
 GO:0009069 serine family amino acid metabolic process
Gene Ontology
 GO:0009058 biosynthetic process
Gene Ontology
 GO:0008652 cellular amino acid biosynthetic process
Gene Ontology
 GO:0008483 transaminase activity
Gene Ontology
 GO:0008453 alanine-glyoxylate transaminase activity
Gene Ontology
 GO:0008152 metabolic process
Gene Ontology
 GO:0008150 biological_process
Gene Ontology
 GO:0006807 nitrogen compound metabolic process
Gene Ontology
 GO:0006545 glycine biosynthetic process
Gene Ontology
 GO:0006544 glycine metabolic process
Gene Ontology
 GO:0006520 cellular amino acid metabolic process
Gene Ontology
 GO:0006082 organic acid metabolic process
Gene Ontology
 GO:0005777 peroxisome
Gene Ontology
 GO:0005737 cytoplasm
Gene Ontology
 GO:0005623 obsolete cell
Gene Ontology
 GO:0005622 intracellular anatomical structure
Gene Ontology
 GO:0005575 cellular_component
Gene Ontology
 GO:0004760 serine-pyruvate transaminase activity
Gene Ontology
 GO:0003824 catalytic activity
Gene Ontology
 GO:0003674 molecular_function
Gene Ontology
 GO:0001505 regulation of neurotransmitter levels
Eggnog Protein
 EP:pucG
Eggnog Ortholog
 EO:COG0075
Eggnog Description
 ED:Aminotransferase class-V
EC Number
 EC:2.6.1.51 serine---pyruvate transaminase; SPT; hydroxypyruvate:L-alanine transaminase kornec00260kornec01100
EC Number
 EC:2.6.1.45 serine---glyoxylate transaminase kornec00260kornec00630kornec00680kornec01100kornec01110kornec01120
EC Number
 EC:2.6.1.44 alanine---glyoxylate transaminase; AGT; alanine-glyoxylate aminotransferase; alanine-glyoxylic aminotransferase; L-alanine-glycine transaminase kornec00250kornec00260kornec00270kornec01100kornec01110
EC Number
 EC:2.6.1.112 (S)-ureidoglycine---glyoxylate transaminase; (S)-ureidoglycine---glyoxylate aminotransferase; UGXT; PucG kornec00230kornec01100
Gene Product
 alanine--glyoxylate aminotransferase family protein

Occurs in the following pathway maps:

Pathway Description
kornec00230 Purine metabolism
kornec00250 Alanine, aspartate and glutamate metabolism
kornec00260 Glycine, serine and threonine metabolism
kornec00270 Cysteine and methionine metabolism
kornec00630 Glyoxylate and dicarboxylate metabolism
kornec00680 Methane metabolism
kornec01100 Metabolic pathways
kornec01110 Biosynthesis of secondary metabolites
kornec01120 Microbial metabolism in diverse environments
kornec01200 Carbon metabolism
kornec04146 Peroxisome

Sequences

Nucleotide sequence (GC-content: 54.7 %):

ATGACCCCGGGGCCGGTTTCAATCGACCCGCGGGTTTCCCAAGCCATGAGCAACCGGATCTTAGGCCAATTTGATCCTGATTTCTTAACCATCATGGACGACACGATGGAACTGACCCGCCAAGCCTTTGAAACGAAGAACAAGTGGGCCTTTGCCGTTGACGGTTCTGGCCGCGCCGGCTTAGAAGCCCTGATGAGCAACATCATCAGCAAGGGTGACAAGGTCTTAGTTCCCGTTTTAGGCCGTTTCGGTAACCTGGGGATTGAACTCGCACAACGGGCCGGCGGAGAAGTCATCACCATGGAAACCGAGTGGGGAACGGTGTTTGACCAAGACGAAATCATTGCTAAGATTAAGGAAGTTAAGCCAAAAGTGGTGGCAATTGTCCACGGGGAAACCTCGACAGGACGCCTGCAACCAATTGACCGGTTGGGGGCCGCCGTAAGAGAAGTGGGCGGTTTCTTAGTGGTCGACGCGGTGGCTTCCTTTATGGGAGCGCCCGTTAAGGCCGACGAATGGCAAATCGATGCCGTCGTGGGGGGCTCACAAAAGTGTTTGGGTGCCTTACCGGGGATGTCATTAGTGACCTTTAACGACCGGTTTGCGGACGAAATCAACAAGCGTAAGCGGATTGAATTAGGGGTGCGGGGAGAAGACGCCCAAACCGCCGCTAACTTTGTCCCGAGCAACTACCTTGATTTAACCCAGCTACAAGACTACTGGTCACCAGCCCGGGTTAACCACCACACCGAAGCCACGATTGGTATCTACGGGGTTTACGAAGCCCTGCGCTTAGGGGTTCAAGAAGAGGGGCTGGCCAACCGTTTTGCCCGCCACCAGCAAGTACACCAAGCCTTAAACAACGCCGTTAAGGCCCTGGGCTTAACGATCTTTAACGAGGGGGACCACGAAATGCCAATGGTCACCTGCGTTGAGATTCCGGAAGCACTACGGGACACCAATTTCCAAAGCGAACTCTTAACCAAGTTTGGGGTTGAAATTGCGGCCTCCTTCGGGAGTTTGCAAGGAAAGATTTGGCGACTGGGAACGATGGGCTACGTGGCCCAAAAGGGTTACCTAGTTCGCTTCATCTCCATCTTTGGGGCCGCCCTCTTGCAAGCGGGCTACCCGGCTGACGTGAAGGCCTCCCTCGACGCAGTAGACCAAGCCTTCGCATAA

Protein sequence:

MTPGPVSIDPRVSQAMSNRILGQFDPDFLTIMDDTMELTRQAFETKNKWAFAVDGSGRAGLEALMSNIISKGDKVLVPVLGRFGNLGIELAQRAGGEVITMETEWGTVFDQDEIIAKIKEVKPKVVAIVHGETSTGRLQPIDRLGAAVREVGGFLVVDAVASFMGAPVKADEWQIDAVVGGSQKCLGALPGMSLVTFNDRFADEINKRKRIELGVRGEDAQTAANFVPSNYLDLTQLQDYWSPARVNHHTEATIGIYGVYEALRLGVQEEGLANRFARHQQVHQALNNAVKALGLTIFNEGDHEMPMVTCVEIPEALRDTNFQSELLTKFGVEIAASFGSLQGKIWRLGTMGYVAQKGYLVRFISIFGAALLQAGYPADVKASLDAVDQAFA

GenBank Info

locus_tag - FAM19471-i1-1.1_000773
inference - COORDINATES: similar to AA sequence:RefSeq:WP_004466607.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - alanine--glyoxylate aminotransferase family protein
protein_id - extdb:FAM19471-i1-1.1_000773

Gene Locus

Located on scaffold FAM19471-i1-1_scf10

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0204: GO:0005777 peroxisome
SL-0166: GO:0043231 intracellular membrane-bounded organelle
FAM19471-i1-1.1_000772
FAM19471-i1-1.1_000774